ADAM8 Rabbit Polyclonal Antibody
ADAM8 Polyclonal Antibody |
ABP57712-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ADAM8 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ADAM8 from Human. This ADAM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADAM8 protein |
ADAM8 Polyclonal Antibody |
ABP57712-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ADAM8 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ADAM8 from Human. This ADAM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADAM8 protein |
ADAM8 Polyclonal Antibody |
ABP57712-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ADAM8 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ADAM8 from Human. This ADAM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADAM8 protein |
ADAM8 Polyclonal Antibody |
A69791 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
ADAM8 Rabbit pAb |
A9578-100ul |
Abclonal |
100 ul |
EUR 308 |
ADAM8 Rabbit pAb |
A9578-200ul |
Abclonal |
200 ul |
EUR 459 |
ADAM8 Rabbit pAb |
A9578-20ul |
Abclonal |
20 ul |
Ask for price |
ADAM8 Rabbit pAb |
A9578-50ul |
Abclonal |
50 ul |
Ask for price |
ADAM8 Rabbit pAb |
A10497-100ul |
Abclonal |
100 ul |
EUR 308 |
ADAM8 Rabbit pAb |
A10497-200ul |
Abclonal |
200 ul |
EUR 459 |
ADAM8 Rabbit pAb |
A10497-20ul |
Abclonal |
20 ul |
EUR 183 |
ADAM8 Rabbit pAb |
A10497-50ul |
Abclonal |
50 ul |
EUR 223 |
ADAM8 Rabbit pAb |
A15022-100ul |
Abclonal |
100 ul |
EUR 308 |
ADAM8 Rabbit pAb |
A15022-200ul |
Abclonal |
200 ul |
EUR 459 |
ADAM8 Rabbit pAb |
A15022-20ul |
Abclonal |
20 ul |
EUR 183 |
ADAM8 Rabbit pAb |
A15022-50ul |
Abclonal |
50 ul |
EUR 223 |
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
DLR-ADAM8-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
DLR-ADAM8-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
DLR-ADAM8-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
DLR-ADAM8-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
DLR-ADAM8-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
DLR-ADAM8-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 8 (ADAM8) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RD-ADAM8-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RD-ADAM8-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RD-ADAM8-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RD-ADAM8-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RD-ADAM8-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RD-ADAM8-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RDR-ADAM8-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RDR-ADAM8-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RDR-ADAM8-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RDR-ADAM8-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RDR-ADAM8-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat A Disintegrin And Metalloprotease 8 (ADAM8) ELISA Kit |
RDR-ADAM8-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rabbit ADAM8 ELISA Kit |
ERTA0737 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal ADAM8 Antibody (N-term) |
APR03901G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM8 (N-term). This antibody is tested and proven to work in the following applications: |
ADAM8 Polyclonal Antibody, HRP Conjugated |
A69792 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
ADAM8 Polyclonal Antibody, FITC Conjugated |
A69793 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
ADAM8 Polyclonal Antibody, Biotin Conjugated |
A69794 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
ADAM8 antibody |
70R-9938 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal ADAM8 antibody |
ADAM8 Antibody |
44547-100ul |
SAB |
100ul |
EUR 252 |
ADAM8 Antibody |
44547-50ul |
SAB |
50ul |
EUR 187 |
ADAM8 Antibody |
DF10153 |
Affbiotech |
200ul |
EUR 304 |
Description: ADAM8 Antibody detects endogenous levels of total ADAM8. |
ADAM8 Antibody |
1-CSB-PA10259A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200 |
ADAM8 Conjugated Antibody |
C44547 |
SAB |
100ul |
EUR 397 |
anti- ADAM8 antibody |
FNab00144 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IHC: 1:20-1:200
- Immunogen: ADAM metallopeptidase domain 8
- Uniprot ID: P78325
- Gene ID: 101
- Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Neuroscience
|
Description: Antibody raised against ADAM8 |
Anti-ADAM8 antibody |
STJ111751 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants. |
Anti-ADAM8 antibody |
STJ112521 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants. |
Anti-ADAM8 antibody |
STJ117216 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants. |
Anti-ADAM8 antibody |
STJ192019 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ADAM8 |
Polyclonal Goat Anti-MS2 / ADAM8 / CD156 Antibody |
APG00203G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MS2 / ADAM8 / CD156 . This antibody is tested and proven to work in the following applications: |
ADAM8 siRNA |
20-abx906740 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADAM8 siRNA |
20-abx906741 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADAM8 Antibody, HRP conjugated |
1-CSB-PA10259B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ADAM8 Antibody, FITC conjugated |
1-CSB-PA10259C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ADAM8 Antibody, Biotin conjugated |
1-CSB-PA10259D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ADAM8. Recognizes ADAM8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ADAM8 Blocking Peptide |
33R-5019 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAM8 antibody, catalog no. 70R-9938 |
ADAM8 Blocking Peptide |
DF10153-BP |
Affbiotech |
1mg |
EUR 195 |
ADAM8 cloning plasmid |
CSB-CL001295HU-10ug |
Cusabio |
10ug |
EUR 803 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2475
- Sequence: ATGCGCGGCCTCGGGCTCTGGCTGCTGGGCGCGATGATGCTGCCTGCGATTGCCCCCAGCCGGCCCTGGGCCCTCATGGAGCAGTATGAGGTCGTGTTGCCGCGGCGTCTGCCAGGCCCCCGAGTCCGCCGAGCTCTGCCCTCCCACTTGGGCCTGCACCCAGAGAGGGTGAGCT
- Show more
|
Description: A cloning plasmid for the ADAM8 gene. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human) |
4-PAA620Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8) |
Rabbit ADAM Metallopeptidase Domain 8 (ADAM8) ELISA Kit |
abx363171-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), APC |
4-PAA620Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), Biotinylated |
4-PAA620Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Biotin. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), Cy3 |
4-PAA620Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Cy3. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), FITC |
4-PAA620Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with FITC. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), HRP |
4-PAA620Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with HRP. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), PE |
4-PAA620Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with PE. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse) |
4-PAA620Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8) |
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody |
20-abx124086 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody |
20-abx125491 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody |
20-abx147984 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody |
abx027773-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody |
abx027773-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
ADAM Metallopeptidase Domain 8 (ADAM8) Antibody |
abx230144-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Human ADAM8 ELISA Kit |
EHA0737 |
Abclonal |
96Tests |
EUR 521 |
Goat ADAM8 ELISA Kit |
EGTA0737 |
Abclonal |
96Tests |
EUR 521 |
Canine ADAM8 ELISA Kit |
ECA0737 |
Abclonal |
96Tests |
EUR 521 |
Chicken ADAM8 ELISA Kit |
ECKA0737 |
Abclonal |
96Tests |
EUR 521 |
Bovine ADAM8 ELISA Kit |
EBA0737 |
Abclonal |
96Tests |
EUR 521 |
Anserini ADAM8 ELISA Kit |
EAA0737 |
Abclonal |
96Tests |
EUR 521 |
Rat ADAM8 ELISA Kit |
ERA0737 |
Abclonal |
96Tests |
EUR 521 |
Sheep ADAM8 ELISA Kit |
ESA0737 |
Abclonal |
96Tests |
EUR 521 |
Porcine ADAM8 ELISA Kit |
EPA0737 |
Abclonal |
96Tests |
EUR 521 |
Mouse ADAM8 ELISA Kit |
EMA0737 |
Abclonal |
96Tests |
EUR 521 |
Monkey ADAM8 ELISA Kit |
EMKA0737 |
Abclonal |
96Tests |
EUR 521 |
Human ADAM8 shRNA Plasmid |
20-abx950065 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ADAM8 shRNA Plasmid |
20-abx969038 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ADAM8 Recombinant Protein (Human) |
RP036442 |
ABM |
100 ug |
Ask for price |
ADAM8 Recombinant Protein (Mouse) |
RP114275 |
ABM |
100 ug |
Ask for price |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA620Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Ser371~Glu587)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC-Cy7. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), APC |
4-PAA620Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with APC. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAA620Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Biotin. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAA620Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with Cy3. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), FITC |
4-PAA620Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with FITC. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), HRP |
4-PAA620Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with HRP. |
A Disintegrin And Metalloprotease 8 (ADAM8) Polyclonal Antibody (Human, Mouse), PE |
4-PAA620Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADAM8 (Glu145~Cys493)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse A Disintegrin And Metalloprotease 8 (ADAM8). This antibody is labeled with PE. |
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody |
20-abx128719 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody |
20-abx129645 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody |
20-abx171034 |
Abbexa |
|
|
|
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody |
20-abx175200 |
Abbexa |
|
|
|
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody |
20-abx175201 |
Abbexa |
|
|
|
A Disintegrin And Metalloprotease 8 (ADAM8) Antibody |
20-abx338630 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Human ADAM8 |
EK5261 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ADAM8 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human ADAM8 PicoKine ELISA Kit |
EK0650 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human ADAM8 in cell culture supernates and serum. |
Guinea Pig ADAM8 ELISA Kit |
EGA0737 |
Abclonal |
96Tests |
EUR 521 |
Adam8 ORF Vector (Mouse) (pORF) |
ORF038093 |
ABM |
1.0 ug DNA |
EUR 506 |
ADAM8 ORF Vector (Human) (pORF) |
ORF012148 |
ABM |
1.0 ug DNA |
EUR 354 |
Recombinant human ADAM8/CD156a Protein |
RP01201 |
Abclonal |
10 μg |
EUR 230 |
ADAM8 ELISA Kit (Human) (OKAN05576) |
OKAN05576 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.37 pg/mL |
ADAM8 ELISA Kit (Human) (OKCD06587) |
OKCD06587 |
Aviva Systems Biology |
96 Wells |
EUR 753 |
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene may be involved in cell adhesion during neurodegeneration, and it is thought to be a target for allergic respiratory diseases, including asthma. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.52pg/mL |
ADAM8 Rabbit Polyclonal Antibody