ADCY3 Rabbit Polyclonal Antibody

ADCY3 Rabbit Polyclonal Antibody

ADCY3 Rabbit pAb

A7870-100ul 100 ul
EUR 308

ADCY3 Rabbit pAb

A7870-200ul 200 ul
EUR 459

ADCY3 Rabbit pAb

A7870-20ul 20 ul
EUR 183

ADCY3 Rabbit pAb

A7870-50ul 50 ul
EUR 223

ADCY3 Antibody

ABD2370 100 ug
EUR 438

ADCY3 Antibody

36250-100ul 100ul
EUR 252

ADCY3 antibody

70R-14937 100 ul
EUR 392
Description: Rabbit polyclonal ADCY3 antibody

ADCY3 antibody

70R-15592 50 ul
EUR 435
Description: Rabbit polyclonal ADCY3 antibody

ADCY3 Antibody

DF2370 200ul
EUR 304
Description: ADCY3 antibody detects endogenous levels of total ADCY3.

ADCY3 Antibody

1-CSB-PA001339GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ADCY3. Recognizes ADCY3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

ADCY3 Antibody

1-CSB-PA241921
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADCY3. Recognizes ADCY3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

ADCY3 Antibody

1-CSB-PA106602
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADCY3. Recognizes ADCY3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

Rabbit ADCY3 ELISA Kit

ERTA0495 96Tests
EUR 521

ADCY3 Conjugated Antibody

C36250 100ul
EUR 397

anti- ADCY3 antibody

FNab00156 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • IP: 1:200-1:2000
  • IF: 1:20-1:200
  • Immunogen: adenylate cyclase 3
  • Uniprot ID: O60266
  • Gene ID: 109
  • Research Area: Neuroscience, Signal Transduction, Metabolism
Description: Antibody raised against ADCY3

Anti-ADCY3 antibody

PAab00156 100 ug
EUR 355

Anti-ADCY3 Antibody

STJ502055 100 µg
EUR 515

Anti-ADCY3 antibody

STJ110180 100 µl
EUR 277
Description: This gene encodes adenylyl cyclase 3 which is a membrane-associated enzyme and catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This protein appears to be widely expressed in various human tissues and may be involved in a number of physiological and pathophysiological metabolic processes. Two transcript variants encoding different isoforms have been found for this gene.

Anti-ADCY3 antibody

STJ191725 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ADCY3

Adcy3/ Rat Adcy3 ELISA Kit

ELI-49656r 96 Tests
EUR 886

Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human)

4-PAB412Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3)

ADCY3 siRNA

20-abx900182
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADCY3 siRNA

20-abx906822
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADCY3 siRNA

20-abx906823
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-ADCY3 Antibody (Biotin)

STJ502066 100 µg
EUR 586

Anti-ADCY3 Antibody (FITC)

STJ502067 100 µg
EUR 586

Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), APC

4-PAB412Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with APC.

Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), Biotinylated

4-PAB412Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with Biotin.

Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), Cy3

4-PAB412Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with Cy3.

Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), FITC

4-PAB412Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with FITC.

Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), HRP

4-PAB412Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with HRP.

Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), PE

4-PAB412Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with PE.

Rabbit Adenylate Cyclase 3 (ADCY3) ELISA Kit

abx362373-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ADCY3 Blocking Peptide

DF2370-BP 1mg
EUR 195

ADCY3 cloning plasmid

CSB-CL001339HU-10ug 10ug
EUR 1255
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3435
  • Sequence: atgccgaggaaccagggcttctccgagcccgaatactcggccgagtactcagccgagtactccgtcagcctgccctccgaccctgaccgcggggtgggccggacccatgaaatctcggtccggaactcgggctcctgcctgtgcctgcctcgcttcatgcggctgactttcgtgc
  • Show more
Description: A cloning plasmid for the ADCY3 gene.

Recombinant Human ADCY3

P0521 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: O60266
Description: Recombinant Human protein for ADCY3

Adenylate Cyclase 3 (ADCY3) Antibody

20-abx110847
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenylate Cyclase 3 (ADCY3) Antibody

20-abx101937
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Adenylate Cyclase 3 (ADCY3) Antibody

abx038409-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Adenylate Cyclase 3 (ADCY3) Antibody

20-abx007083
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenylate Cyclase 3 (ADCY3) Antibody

20-abx214544
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenylate Cyclase 3 (ADCY3) Antibody

20-abx214685
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenylate Cyclase 3 (ADCY3) Antibody

abx230156-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), APC-Cy7

4-PAB412Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADCY3 (Lys501~Asn736)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with APC-Cy7.

Mouse ADCY3 shRNA Plasmid

20-abx979619
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ADCY3 shRNA Plasmid

20-abx986259
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ADCY3 ELISA Kit

EHA0495 96Tests
EUR 521

Goat ADCY3 ELISA Kit

EGTA0495 96Tests
EUR 521

Canine ADCY3 ELISA Kit

ECA0495 96Tests
EUR 521

Bovine ADCY3 ELISA Kit

EBA0495 96Tests
EUR 521

Anserini ADCY3 ELISA Kit

EAA0495 96Tests
EUR 521

ADCY3 ELISA KIT|Human

EF007620 96 Tests
EUR 689

Rat ADCY3 ELISA Kit

ERA0495 96Tests
EUR 521

Porcine ADCY3 ELISA Kit

EPA0495 96Tests
EUR 521

Mouse ADCY3 ELISA Kit

EMA0495 96Tests
EUR 521

Human ADCY3 shRNA Plasmid

20-abx950072
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Adenylate Cyclase III/ADCY3

RA22114 100 ul
EUR 435

Anti-ADCY3 (Adenylate Cyclase 3)

AR09-PA0001 100 ul
EUR 334
Description: Rabbit polyclonal to Rhe-b

Guinea Pig ADCY3 ELISA Kit

EGA0495 96Tests
EUR 521

Adcy3 ORF Vector (Mouse) (pORF)

ORF038145 1.0 ug DNA
EUR 506

Adcy3 ORF Vector (Mouse) (pORF)

ORF038146 1.0 ug DNA
EUR 506

Adcy3 ORF Vector (Mouse) (pORF)

ORF038147 1.0 ug DNA
EUR 506

ADCY3 ORF Vector (Human) (pORF)

ORF012156 1.0 ug DNA
EUR 354

Adcy3 ORF Vector (Rat) (pORF)

ORF063095 1.0 ug DNA
EUR 506

Recombinant Adenylate Cyclase 3 (ADCY3)

4-RPB412Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60266
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.9kDa
  • Isoelectric Point: 6.3
Description: Recombinant Human Adenylate Cyclase 3 expressed in: E.coli

ADCY3 sgRNA CRISPR Lentivector set (Human)

K0047601 3 x 1.0 ug
EUR 339

Human Adenylate Cyclase 3 (ADCY3) Protein

20-abx065153
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Adcy3 sgRNA CRISPR Lentivector set (Mouse)

K3866601 3 x 1.0 ug
EUR 339

Adcy3 sgRNA CRISPR Lentivector set (Rat)

K6969101 3 x 1.0 ug
EUR 339

Pig Adenylate Cyclase 3 (ADCY3) ELISA Kit

abx361312-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Adenylate Cyclase 3 (ADCY3) ELISA Kit

abx364212-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

ADCY3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0047602 1.0 ug DNA
EUR 154

ADCY3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0047603 1.0 ug DNA
EUR 154

ADCY3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0047604 1.0 ug DNA
EUR 154

Human Adenylate Cyclase 3 (ADCY3) ELISA Kit

abx354307-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Chicken Adenylate Cyclase 3 (ADCY3) ELISA Kit

abx356157-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Adenylate Cyclase 3 (ADCY3) ELISA Kit

abx359569-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Adcy3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3866602 1.0 ug DNA
EUR 154

Adcy3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3866603 1.0 ug DNA
EUR 154

Adcy3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3866604 1.0 ug DNA
EUR 154

Adcy3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6969102 1.0 ug DNA
EUR 154

Adcy3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6969103 1.0 ug DNA
EUR 154

Adcy3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6969104 1.0 ug DNA
EUR 154

ADCY3 Protein Vector (Human) (pPB-C-His)

PV048621 500 ng
EUR 481

ADCY3 Protein Vector (Human) (pPB-N-His)

PV048622 500 ng
EUR 481

ADCY3 Protein Vector (Human) (pPM-C-HA)

PV048623 500 ng
EUR 481

ADCY3 Protein Vector (Human) (pPM-C-His)

PV048624 500 ng
EUR 481

ADCY3 Protein Vector (Human) (pPB-His-MBP)

PV320014 500 ng
EUR 481

ADCY3 Protein Vector (Human) (pPB-His-GST)

PV320015 500 ng
EUR 481

ADCY3 Protein Vector (Mouse) (pPB-C-His)

PV152578 500 ng
EUR 1065

ADCY3 Protein Vector (Mouse) (pPB-N-His)

PV152579 500 ng
EUR 1065

ADCY3 Protein Vector (Mouse) (pPM-C-HA)

PV152580 500 ng
EUR 1065

ADCY3 Protein Vector (Mouse) (pPM-C-His)

PV152581 500 ng
EUR 1065

ADCY3 Protein Vector (Mouse) (pPB-C-His)

PV152582 500 ng
EUR 1065

ADCY3 Protein Vector (Mouse) (pPB-N-His)

PV152583 500 ng
EUR 1065

ADCY3 Protein Vector (Mouse) (pPM-C-HA)

PV152584 500 ng
EUR 1065

ADCY3 Protein Vector (Mouse) (pPM-C-His)

PV152585 500 ng
EUR 1065

ADCY3 Protein Vector (Mouse) (pPB-C-His)

PV152586 500 ng
EUR 1065

ADCY3 Protein Vector (Mouse) (pPB-N-His)

PV152587 500 ng
EUR 1065

ADCY3 Protein Vector (Mouse) (pPM-C-HA)

PV152588 500 ng
EUR 1065

ADCY3 Protein Vector (Mouse) (pPM-C-His)

PV152589 500 ng
EUR 1065

ADCY3 Protein Vector (Rat) (pPB-C-His)

PV252378 500 ng
EUR 1191

ADCY3 Protein Vector (Rat) (pPB-N-His)

PV252379 500 ng
EUR 1191

ADCY3 Protein Vector (Rat) (pPM-C-HA)

PV252380 500 ng
EUR 1191

ADCY3 Protein Vector (Rat) (pPM-C-His)

PV252381 500 ng
EUR 1191

Adcy3 3'UTR Luciferase Stable Cell Line

TU200306 1.0 ml Ask for price

Adcy3 3'UTR GFP Stable Cell Line

TU151425 1.0 ml Ask for price

ADCY3 3'UTR Luciferase Stable Cell Line

TU000356 1.0 ml
EUR 1394

Adcy3 3'UTR Luciferase Stable Cell Line

TU101425 1.0 ml Ask for price

ADCY3 3'UTR GFP Stable Cell Line

TU050356 1.0 ml
EUR 1394

Adcy3 3'UTR GFP Stable Cell Line

TU250306 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ADCY3 Rabbit Polyclonal Antibody