ADCY3 Rabbit Polyclonal Antibody
ADCY3 Rabbit pAb |
A7870-100ul |
Abclonal |
100 ul |
EUR 308 |
ADCY3 Rabbit pAb |
A7870-200ul |
Abclonal |
200 ul |
EUR 459 |
ADCY3 Rabbit pAb |
A7870-20ul |
Abclonal |
20 ul |
EUR 183 |
ADCY3 Rabbit pAb |
A7870-50ul |
Abclonal |
50 ul |
EUR 223 |
ADCY3 Antibody |
36250-100ul |
SAB |
100ul |
EUR 252 |
ADCY3 antibody |
70R-14937 |
Fitzgerald |
100 ul |
EUR 392 |
Description: Rabbit polyclonal ADCY3 antibody |
ADCY3 antibody |
70R-15592 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ADCY3 antibody |
ADCY3 Antibody |
DF2370 |
Affbiotech |
200ul |
EUR 304 |
Description: ADCY3 antibody detects endogenous levels of total ADCY3. |
ADCY3 Antibody |
1-CSB-PA001339GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ADCY3. Recognizes ADCY3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
ADCY3 Antibody |
1-CSB-PA241921 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ADCY3. Recognizes ADCY3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200 |
ADCY3 Antibody |
1-CSB-PA106602 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ADCY3. Recognizes ADCY3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
Rabbit ADCY3 ELISA Kit |
ERTA0495 |
Abclonal |
96Tests |
EUR 521 |
ADCY3 Conjugated Antibody |
C36250 |
SAB |
100ul |
EUR 397 |
anti- ADCY3 antibody |
FNab00156 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IHC: 1:20-1:200
- IP: 1:200-1:2000
- IF: 1:20-1:200
- Immunogen: adenylate cyclase 3
- Uniprot ID: O60266
- Gene ID: 109
- Research Area: Neuroscience, Signal Transduction, Metabolism
|
Description: Antibody raised against ADCY3 |
Anti-ADCY3 antibody |
STJ110180 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes adenylyl cyclase 3 which is a membrane-associated enzyme and catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This protein appears to be widely expressed in various human tissues and may be involved in a number of physiological and pathophysiological metabolic processes. Two transcript variants encoding different isoforms have been found for this gene. |
Anti-ADCY3 antibody |
STJ191725 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ADCY3 |
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human) |
4-PAB412Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3) |
ADCY3 siRNA |
20-abx900182 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADCY3 siRNA |
20-abx906822 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ADCY3 siRNA |
20-abx906823 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), APC |
4-PAB412Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with APC. |
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), Biotinylated |
4-PAB412Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with Biotin. |
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), Cy3 |
4-PAB412Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with Cy3. |
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), FITC |
4-PAB412Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with FITC. |
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), HRP |
4-PAB412Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with HRP. |
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), PE |
4-PAB412Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with PE. |
Rabbit Adenylate Cyclase 3 (ADCY3) ELISA Kit |
abx362373-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ADCY3 Blocking Peptide |
DF2370-BP |
Affbiotech |
1mg |
EUR 195 |
ADCY3 cloning plasmid |
CSB-CL001339HU-10ug |
Cusabio |
10ug |
EUR 1255 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3435
- Sequence: atgccgaggaaccagggcttctccgagcccgaatactcggccgagtactcagccgagtactccgtcagcctgccctccgaccctgaccgcggggtgggccggacccatgaaatctcggtccggaactcgggctcctgcctgtgcctgcctcgcttcatgcggctgactttcgtgc
- Show more
|
Description: A cloning plasmid for the ADCY3 gene. |
Recombinant Human ADCY3 |
P0521 |
FN Test |
100ug |
EUR 522.36 |
- Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
- Reconstitution: Sterile distilled water
- Purity: Greater than 95% by SDS-PAGE gel analyses
- Uniprot ID: O60266
|
Description: Recombinant Human protein for ADCY3 |
Adenylate Cyclase 3 (ADCY3) Antibody |
20-abx110847 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Adenylate Cyclase 3 (ADCY3) Antibody |
20-abx101937 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Adenylate Cyclase 3 (ADCY3) Antibody |
abx038409-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Adenylate Cyclase 3 (ADCY3) Antibody |
20-abx007083 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Adenylate Cyclase 3 (ADCY3) Antibody |
20-abx214544 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Adenylate Cyclase 3 (ADCY3) Antibody |
20-abx214685 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Adenylate Cyclase 3 (ADCY3) Antibody |
abx230156-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Adenylate Cyclase 3 (ADCY3) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB412Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ADCY3 (Lys501~Asn736)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Adenylate Cyclase 3 (ADCY3). This antibody is labeled with APC-Cy7. |
Mouse ADCY3 shRNA Plasmid |
20-abx979619 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat ADCY3 shRNA Plasmid |
20-abx986259 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ADCY3 ELISA Kit |
EHA0495 |
Abclonal |
96Tests |
EUR 521 |
Goat ADCY3 ELISA Kit |
EGTA0495 |
Abclonal |
96Tests |
EUR 521 |
Canine ADCY3 ELISA Kit |
ECA0495 |
Abclonal |
96Tests |
EUR 521 |
Bovine ADCY3 ELISA Kit |
EBA0495 |
Abclonal |
96Tests |
EUR 521 |
Anserini ADCY3 ELISA Kit |
EAA0495 |
Abclonal |
96Tests |
EUR 521 |
Rat ADCY3 ELISA Kit |
ERA0495 |
Abclonal |
96Tests |
EUR 521 |
Porcine ADCY3 ELISA Kit |
EPA0495 |
Abclonal |
96Tests |
EUR 521 |
Mouse ADCY3 ELISA Kit |
EMA0495 |
Abclonal |
96Tests |
EUR 521 |
Human ADCY3 shRNA Plasmid |
20-abx950072 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Adenylate Cyclase III/ADCY3 |
RA22114 |
Neuromics |
100 ul |
EUR 435 |
Anti-ADCY3 (Adenylate Cyclase 3) |
AR09-PA0001 |
Abfrontier |
100 ul |
EUR 334 |
Description: Rabbit polyclonal to Rhe-b |
Guinea Pig ADCY3 ELISA Kit |
EGA0495 |
Abclonal |
96Tests |
EUR 521 |
Adcy3 ORF Vector (Mouse) (pORF) |
ORF038145 |
ABM |
1.0 ug DNA |
EUR 506 |
Adcy3 ORF Vector (Mouse) (pORF) |
ORF038146 |
ABM |
1.0 ug DNA |
EUR 506 |
Adcy3 ORF Vector (Mouse) (pORF) |
ORF038147 |
ABM |
1.0 ug DNA |
EUR 506 |
ADCY3 ORF Vector (Human) (pORF) |
ORF012156 |
ABM |
1.0 ug DNA |
EUR 354 |
Adcy3 ORF Vector (Rat) (pORF) |
ORF063095 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Adenylate Cyclase 3 (ADCY3) |
4-RPB412Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O60266
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.9kDa
- Isoelectric Point: 6.3
|
Description: Recombinant Human Adenylate Cyclase 3 expressed in: E.coli |
ADCY3 sgRNA CRISPR Lentivector set (Human) |
K0047601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Adenylate Cyclase 3 (ADCY3) Protein |
20-abx065153 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Adcy3 sgRNA CRISPR Lentivector set (Mouse) |
K3866601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Adcy3 sgRNA CRISPR Lentivector set (Rat) |
K6969101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pig Adenylate Cyclase 3 (ADCY3) ELISA Kit |
abx361312-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Adenylate Cyclase 3 (ADCY3) ELISA Kit |
abx364212-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
ADCY3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0047602 |
ABM |
1.0 ug DNA |
EUR 154 |
ADCY3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0047603 |
ABM |
1.0 ug DNA |
EUR 154 |
ADCY3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0047604 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Adenylate Cyclase 3 (ADCY3) ELISA Kit |
abx354307-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Chicken Adenylate Cyclase 3 (ADCY3) ELISA Kit |
abx356157-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Adenylate Cyclase 3 (ADCY3) ELISA Kit |
abx359569-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Adcy3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3866602 |
ABM |
1.0 ug DNA |
EUR 154 |
Adcy3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3866603 |
ABM |
1.0 ug DNA |
EUR 154 |
Adcy3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3866604 |
ABM |
1.0 ug DNA |
EUR 154 |
Adcy3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6969102 |
ABM |
1.0 ug DNA |
EUR 154 |
Adcy3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6969103 |
ABM |
1.0 ug DNA |
EUR 154 |
Adcy3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6969104 |
ABM |
1.0 ug DNA |
EUR 154 |
ADCY3 Protein Vector (Human) (pPB-C-His) |
PV048621 |
ABM |
500 ng |
EUR 481 |
ADCY3 Protein Vector (Human) (pPB-N-His) |
PV048622 |
ABM |
500 ng |
EUR 481 |
ADCY3 Protein Vector (Human) (pPM-C-HA) |
PV048623 |
ABM |
500 ng |
EUR 481 |
ADCY3 Protein Vector (Human) (pPM-C-His) |
PV048624 |
ABM |
500 ng |
EUR 481 |
ADCY3 Protein Vector (Human) (pPB-His-MBP) |
PV320014 |
ABM |
500 ng |
EUR 481 |
ADCY3 Protein Vector (Human) (pPB-His-GST) |
PV320015 |
ABM |
500 ng |
EUR 481 |
ADCY3 Protein Vector (Mouse) (pPB-C-His) |
PV152578 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPB-N-His) |
PV152579 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPM-C-HA) |
PV152580 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPM-C-His) |
PV152581 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPB-C-His) |
PV152582 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPB-N-His) |
PV152583 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPM-C-HA) |
PV152584 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPM-C-His) |
PV152585 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPB-C-His) |
PV152586 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPB-N-His) |
PV152587 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPM-C-HA) |
PV152588 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Mouse) (pPM-C-His) |
PV152589 |
ABM |
500 ng |
EUR 1065 |
ADCY3 Protein Vector (Rat) (pPB-C-His) |
PV252378 |
ABM |
500 ng |
EUR 1191 |
ADCY3 Protein Vector (Rat) (pPB-N-His) |
PV252379 |
ABM |
500 ng |
EUR 1191 |
ADCY3 Protein Vector (Rat) (pPM-C-HA) |
PV252380 |
ABM |
500 ng |
EUR 1191 |
ADCY3 Protein Vector (Rat) (pPM-C-His) |
PV252381 |
ABM |
500 ng |
EUR 1191 |
Adcy3 3'UTR Luciferase Stable Cell Line |
TU200306 |
ABM |
1.0 ml |
Ask for price |
Adcy3 3'UTR GFP Stable Cell Line |
TU151425 |
ABM |
1.0 ml |
Ask for price |
ADCY3 3'UTR Luciferase Stable Cell Line |
TU000356 |
ABM |
1.0 ml |
EUR 1394 |
Adcy3 3'UTR Luciferase Stable Cell Line |
TU101425 |
ABM |
1.0 ml |
Ask for price |
ADCY3 3'UTR GFP Stable Cell Line |
TU050356 |
ABM |
1.0 ml |
EUR 1394 |
Adcy3 3'UTR GFP Stable Cell Line |
TU250306 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ADCY3 Rabbit Polyclonal Antibody