AGFG1 Rabbit Polyclonal Antibody
AGFG1 Polyclonal Antibody |
ABP57725-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human AGFG1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of AGFG1 from Human, Mouse, Rat. This AGFG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AGFG1 protein |
AGFG1 Polyclonal Antibody |
ABP57725-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human AGFG1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of AGFG1 from Human, Mouse, Rat. This AGFG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AGFG1 protein |
AGFG1 Polyclonal Antibody |
ABP57725-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human AGFG1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of AGFG1 from Human, Mouse, Rat. This AGFG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AGFG1 protein |
AGFG1 Rabbit pAb |
A6294-100ul |
Abclonal |
100 ul |
EUR 308 |
AGFG1 Rabbit pAb |
A6294-200ul |
Abclonal |
200 ul |
EUR 459 |
AGFG1 Rabbit pAb |
A6294-20ul |
Abclonal |
20 ul |
EUR 183 |
AGFG1 Rabbit pAb |
A6294-50ul |
Abclonal |
50 ul |
EUR 223 |
AGFG1 Rabbit pAb |
A13500-100ul |
Abclonal |
100 ul |
EUR 308 |
AGFG1 Rabbit pAb |
A13500-200ul |
Abclonal |
200 ul |
EUR 459 |
AGFG1 Rabbit pAb |
A13500-20ul |
Abclonal |
20 ul |
EUR 183 |
AGFG1 Rabbit pAb |
A13500-50ul |
Abclonal |
50 ul |
EUR 223 |
AGFG1 Antibody |
36061-100ul |
SAB |
100ul |
EUR 252 |
AGFG1 antibody |
38801-100ul |
SAB |
100ul |
EUR 252 |
AGFG1 antibody |
70R-15623 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal AGFG1 antibody |
AGFG1 Antibody |
1-CSB-PA001442GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against AGFG1. Recognizes AGFG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
AGFG1 Antibody |
1-CSB-PA015892 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against AGFG1. Recognizes AGFG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
AGFG1 Antibody |
1-CSB-PA030856 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against AGFG1. Recognizes AGFG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
Polyclonal AGFG1 Antibody (N-term) |
APR14875G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AGFG1 (N-term). This antibody is tested and proven to work in the following applications: |
AGFG1 Conjugated Antibody |
C38801 |
SAB |
100ul |
EUR 397 |
AGFG1 Conjugated Antibody |
C36061 |
SAB |
100ul |
EUR 397 |
anti- AGFG1 antibody |
FNab00210 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IP: 1:200-1:1000
- IHC: 1:20-1:200
- Immunogen: ArfGAP with FG repeats 1
- Uniprot ID: P52594
- Gene ID: 3267
- Research Area: Immunology, Signal Transduction, Developmental biology
|
Description: Antibody raised against AGFG1 |
Anti-AGFG1 Antibody |
RP1071 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-AGFG1 antibody |
STJ28216 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is related to nucleoporins, a class of proteins that mediate nucleocytoplasmic transport. The encoded protein binds the activation domain of the human immunodeficiency virus Rev protein when Rev is assembled onto its RNA target, and is required for the nuclear export of Rev-directed RNAs. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-AGFG1 antibody |
STJ115461 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is related to nucleoporins, a class of proteins that mediate nucleocytoplasmic transport. The encoded protein binds the activation domain of the human immunodeficiency virus Rev protein when Rev is assembled onto its RNA target, and is required for the nuclear export of Rev-directed RNAs. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-AGFG1 antibody |
STJ191953 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to AGFG1 |
AGFG1 siRNA |
20-abx900220 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AGFG1 siRNA |
20-abx906993 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AGFG1 siRNA |
20-abx906994 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-AGFG1 |
YF-PA12452 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to AGFG1 |
AGFG1 cloning plasmid |
CSB-CL001442HU1-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1689
- Sequence: atggcggccagcgcgaagcggaagcaggaggagaagcacctgaagatgctgcgggacatgaccggcctcccgcacaaccgaaagtgcttcgactgcgaccagcgcggccccacctacgttaacatgacggtcggctccttcgtgtgtacctcctgctccggcagcctgcgaggat
- Show more
|
Description: A cloning plasmid for the AGFG1 gene. |
AGFG1 cloning plasmid |
CSB-CL001442HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1689
- Sequence: ATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCACCTGAAGATGCTGCGGGACATGACCGGCCTCCCGCACAACCGAAAGTGCTTCGACTGCGACCAGCGCGGCCCCACCTACGTTAACATGACGGTCGGCTCCTTCGTGTGTACCTCCTGCTCCGGCAGCCTGCGAGGAT
- Show more
|
Description: A cloning plasmid for the AGFG1 gene. |
Rat AGFG1 shRNA Plasmid |
20-abx990532 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse AGFG1 shRNA Plasmid |
20-abx970892 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human AGFG1 shRNA Plasmid |
20-abx952235 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
AGFG1 Recombinant Protein (Human) |
RP000715 |
ABM |
100 ug |
Ask for price |
AGFG1 Recombinant Protein (Human) |
RP036514 |
ABM |
100 ug |
Ask for price |
AGFG1 Recombinant Protein (Rat) |
RP189506 |
ABM |
100 ug |
Ask for price |
AGFG1 Recombinant Protein (Mouse) |
RP114767 |
ABM |
100 ug |
Ask for price |
ArfGAP With FG Repeats 1 (AGFG1) Antibody |
20-abx111048 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ArfGAP With FG Repeats 1 (AGFG1) Antibody |
20-abx004810 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
ArfGAP With FG Repeats 1 (AGFG1) Antibody |
abx028646-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
ArfGAP With FG Repeats 1 (AGFG1) Antibody |
abx028646-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
ArfGAP With FG Repeats 1 (AGFG1) Antibody |
20-abx242050 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ArfGAP With FG Repeats 1 (AGFG1) Antibody |
20-abx242051 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ArfGAP With FG Repeats 1 (AGFG1) Antibody |
20-abx225018 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
ArfGAP With FG Repeats 1 (AGFG1) Antibody |
abx230210-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
AGFG1 Rabbit Polyclonal Antibody