AGFG1 Rabbit Polyclonal Antibody

AGFG1 Rabbit Polyclonal Antibody

AGFG1 Polyclonal Antibody

ABP57725-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AGFG1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of AGFG1 from Human, Mouse, Rat. This AGFG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AGFG1 protein

AGFG1 Polyclonal Antibody

ABP57725-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AGFG1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of AGFG1 from Human, Mouse, Rat. This AGFG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AGFG1 protein

AGFG1 Polyclonal Antibody

ABP57725-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AGFG1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of AGFG1 from Human, Mouse, Rat. This AGFG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AGFG1 protein

AGFG1 Rabbit pAb

A6294-100ul 100 ul
EUR 308

AGFG1 Rabbit pAb

A6294-200ul 200 ul
EUR 459

AGFG1 Rabbit pAb

A6294-20ul 20 ul
EUR 183

AGFG1 Rabbit pAb

A6294-50ul 50 ul
EUR 223

AGFG1 Rabbit pAb

A13500-100ul 100 ul
EUR 308

AGFG1 Rabbit pAb

A13500-200ul 200 ul
EUR 459

AGFG1 Rabbit pAb

A13500-20ul 20 ul
EUR 183

AGFG1 Rabbit pAb

A13500-50ul 50 ul
EUR 223

AGFG1 Antibody

36061-100ul 100ul
EUR 252

AGFG1 antibody

38801-100ul 100ul
EUR 252

AGFG1 antibody

70R-15623 50 ul
EUR 435
Description: Rabbit polyclonal AGFG1 antibody

AGFG1 Antibody

1-CSB-PA001442GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AGFG1. Recognizes AGFG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

AGFG1 Antibody

1-CSB-PA015892
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGFG1. Recognizes AGFG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

AGFG1 Antibody

1-CSB-PA030856
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGFG1. Recognizes AGFG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

Polyclonal AGFG1 Antibody (N-term)

APR14875G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AGFG1 (N-term). This antibody is tested and proven to work in the following applications:

AGFG1 Conjugated Antibody

C38801 100ul
EUR 397

AGFG1 Conjugated Antibody

C36061 100ul
EUR 397

anti- AGFG1 antibody

FNab00210 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: ArfGAP with FG repeats 1
  • Uniprot ID: P52594
  • Gene ID: 3267
  • Research Area: Immunology, Signal Transduction, Developmental biology
Description: Antibody raised against AGFG1

Anti-AGFG1 antibody

PAab00210 100 ug
EUR 355

Anti-AGFG1 Antibody

RP1071 100ug/vial
EUR 294

Anti-AGFG1 antibody

STJ28216 100 µl
EUR 277
Description: The protein encoded by this gene is related to nucleoporins, a class of proteins that mediate nucleocytoplasmic transport. The encoded protein binds the activation domain of the human immunodeficiency virus Rev protein when Rev is assembled onto its RNA target, and is required for the nuclear export of Rev-directed RNAs. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-AGFG1 antibody

STJ115461 100 µl
EUR 277
Description: The protein encoded by this gene is related to nucleoporins, a class of proteins that mediate nucleocytoplasmic transport. The encoded protein binds the activation domain of the human immunodeficiency virus Rev protein when Rev is assembled onto its RNA target, and is required for the nuclear export of Rev-directed RNAs. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-AGFG1 antibody

STJ191953 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AGFG1

Agfg1/ Rat Agfg1 ELISA Kit

ELI-35157r 96 Tests
EUR 886

AGFG1 siRNA

20-abx900220
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AGFG1 siRNA

20-abx906993
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AGFG1 siRNA

20-abx906994
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-AGFG1

YF-PA12452 50 ul
EUR 363
Description: Mouse polyclonal to AGFG1

AGFG1 cloning plasmid

CSB-CL001442HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1689
  • Sequence: atggcggccagcgcgaagcggaagcaggaggagaagcacctgaagatgctgcgggacatgaccggcctcccgcacaaccgaaagtgcttcgactgcgaccagcgcggccccacctacgttaacatgacggtcggctccttcgtgtgtacctcctgctccggcagcctgcgaggat
  • Show more
Description: A cloning plasmid for the AGFG1 gene.

AGFG1 cloning plasmid

CSB-CL001442HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1689
  • Sequence: ATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCACCTGAAGATGCTGCGGGACATGACCGGCCTCCCGCACAACCGAAAGTGCTTCGACTGCGACCAGCGCGGCCCCACCTACGTTAACATGACGGTCGGCTCCTTCGTGTGTACCTCCTGCTCCGGCAGCCTGCGAGGAT
  • Show more
Description: A cloning plasmid for the AGFG1 gene.

Rat AGFG1 shRNA Plasmid

20-abx990532
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine AGFG1 ELISA KIT

ELI-11609b 96 Tests
EUR 928

Mouse Agfg1 ELISA KIT

ELI-11912m 96 Tests
EUR 865

Human AGFG1 ELISA KIT

ELI-24144h 96 Tests
EUR 824

AGFG1 ELISA KIT|Human

EF007657 96 Tests
EUR 689

Mouse AGFG1 shRNA Plasmid

20-abx970892
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AGFG1 shRNA Plasmid

20-abx952235
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AGFG1 Recombinant Protein (Human)

RP000715 100 ug Ask for price

AGFG1 Recombinant Protein (Human)

RP036514 100 ug Ask for price

AGFG1 Recombinant Protein (Rat)

RP189506 100 ug Ask for price

AGFG1 Recombinant Protein (Mouse)

RP114767 100 ug Ask for price

ArfGAP With FG Repeats 1 (AGFG1) Antibody

20-abx111048
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

ArfGAP With FG Repeats 1 (AGFG1) Antibody

20-abx004810
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ArfGAP With FG Repeats 1 (AGFG1) Antibody

abx028646-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ArfGAP With FG Repeats 1 (AGFG1) Antibody

abx028646-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ArfGAP With FG Repeats 1 (AGFG1) Antibody

20-abx242050
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ArfGAP With FG Repeats 1 (AGFG1) Antibody

20-abx242051
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ArfGAP With FG Repeats 1 (AGFG1) Antibody

20-abx225018
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

ArfGAP With FG Repeats 1 (AGFG1) Antibody

abx230210-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

AGFG1 Rabbit Polyclonal Antibody