AP1G1 Rabbit Polyclonal Antibody
 AP1G1 Polyclonal Antibody |
|
ABP57782-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human AP1G1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of AP1G1 from Human, Mouse. This AP1G1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP1G1 protein |
AP1G1 Polyclonal Antibody |
|
ABP57782-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human AP1G1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of AP1G1 from Human, Mouse. This AP1G1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP1G1 protein |
 AP1G1 antibody |
|
70R-3825 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal AP1G1 antibody raised against the C terminal of AP1G1 |
 AP1G1 Antibody |
|
36741-100ul |
SAB |
100ul |
EUR 252 |
AP1G1 antibody |
|
70R-15746 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal AP1G1 antibody |
AP1G1 Antibody |
|
1-CSB-PA001861GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
AP1G1 Antibody |
|
1-CSB-PA001861LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
AP1G1 Antibody |
|
1-CSB-PA248283 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100 |
 Polyclonal AP1G1 antibody - C-terminal region |
|
APR14953G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AP1G1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 AP1G1 Conjugated Antibody |
|
C36741 |
SAB |
100ul |
EUR 397 |
 Anti-AP1G1 Antibody |
|
A12998 |
BosterBio |
100ug |
EUR 432 |
|
Description: Goat Polyclonal AP1G1 Antibody. Validated in IP, WB and tested in Human. |
 Anti-AP1G1 antibody |
|
STJ192028 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to AP1G1 |
 AP1G1 siRNA |
|
20-abx907703 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AP1G1 siRNA |
|
20-abx907704 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 AP1G1 Antibody, HRP conjugated |
|
1-CSB-PA001861LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 AP1G1 Antibody, FITC conjugated |
|
1-CSB-PA001861LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 AP1G1 Antibody, Biotin conjugated |
|
1-CSB-PA001861LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
) Polyclonal AP1G1 / Adaptin Gamma 1 Antibody (aa646-659) |
|
APR14968G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AP1G1 / Adaptin Gamma 1 (aa646-659). This antibody is tested and proven to work in the following applications: |
 AP1G1 Blocking Peptide |
|
33R-1979 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AP1G1 antibody, catalog no. 70R-3825 |
 AP1G1 cloning plasmid |
|
CSB-CL001861HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2478
- Sequence: atgccagcccccatcagattgcgggagctgatccggaccatccggacagcccgaacccaagctgaagaacgagaaatgatccagaaagaatgtgctgcaatccggtcatcttttagagaagaagacaatacataccgatgtcggaatgtggcaaaattactgtatatgcacatgc
- Show more
|
|
Description: A cloning plasmid for the AP1G1 gene. |
 Human AP1G1 shRNA Plasmid |
|
20-abx950118 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse AP1G1 shRNA Plasmid |
|
20-abx969158 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) AP1G1 Recombinant Protein (Human) |
|
RP001405 |
ABM |
100 ug |
Ask for price |
) AP1G1 Recombinant Protein (Rat) |
|
RP190406 |
ABM |
100 ug |
Ask for price |
) AP1G1 Recombinant Protein (Mouse) |
|
RP116213 |
ABM |
100 ug |
Ask for price |
 (pORF)) AP1G1 ORF Vector (Human) (pORF) |
|
ORF000469 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Ap1g1 ORF Vector (Mouse) (pORF) |
|
ORF038739 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Ap1g1 ORF Vector (Rat) (pORF) |
|
ORF063470 |
ABM |
1.0 ug DNA |
EUR 506 |
 ELISA kit) Rabbit AP 1 complex subunit gamma 1(AP1G1) ELISA kit |
|
E04A1555-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit AP 1 complex subunit gamma 1(AP1G1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit AP 1 complex subunit gamma 1(AP1G1) ELISA kit |
|
E04A1555-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit AP 1 complex subunit gamma 1(AP1G1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit AP 1 complex subunit gamma 1(AP1G1) ELISA kit |
|
E04A1555-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit AP 1 complex subunit gamma 1(AP1G1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) AP-1 Complex Subunit Gamma-1 (AP1G1) Antibody |
|
abx037674-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
AP-1 Complex Subunit Gamma-1 (AP1G1) Antibody |
|
abx038309-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
AP-1 Complex Subunit Gamma-1 (AP1G1) Antibody |
|
20-abx318266 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) AP1G1 sgRNA CRISPR Lentivector set (Human) |
|
K0099601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ap1g1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4761501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ap1g1 sgRNA CRISPR Lentivector set (Rat) |
|
K7122401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) AP1G1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0099602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) AP1G1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0099603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) AP1G1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0099604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ap1g1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4761502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ap1g1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4761503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ap1g1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4761504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ap1g1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7122402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ap1g1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7122403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ap1g1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7122404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) AP1G1 Protein Vector (Human) (pPB-C-His) |
|
PV001873 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) AP1G1 Protein Vector (Human) (pPB-N-His) |
|
PV001874 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) AP1G1 Protein Vector (Human) (pPM-C-HA) |
|
PV001875 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) AP1G1 Protein Vector (Human) (pPM-C-His) |
|
PV001876 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) AP1G1 Protein Vector (Mouse) (pPB-C-His) |
|
PV154954 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) AP1G1 Protein Vector (Mouse) (pPB-N-His) |
|
PV154955 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) AP1G1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV154956 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) AP1G1 Protein Vector (Mouse) (pPM-C-His) |
|
PV154957 |
ABM |
500 ng |
EUR 1065 |
 (pPB-His-MBP)) AP1G1 Protein Vector (Human) (pPB-His-MBP) |
|
PV322510 |
ABM |
500 ng |
EUR 329 |
 (pPB-His-GST)) AP1G1 Protein Vector (Human) (pPB-His-GST) |
|
PV322511 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) AP1G1 Protein Vector (Rat) (pPB-C-His) |
|
PV253878 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) AP1G1 Protein Vector (Rat) (pPB-N-His) |
|
PV253879 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) AP1G1 Protein Vector (Rat) (pPM-C-HA) |
|
PV253880 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) AP1G1 Protein Vector (Rat) (pPM-C-His) |
|
PV253881 |
ABM |
500 ng |
EUR 1166 |
 Ap1g1 3'UTR Luciferase Stable Cell Line |
|
TU200712 |
ABM |
1.0 ml |
Ask for price |
 Ap1g1 3'UTR GFP Stable Cell Line |
|
TU151902 |
ABM |
1.0 ml |
Ask for price |
 AP1G1 3'UTR Luciferase Stable Cell Line |
|
TU000902 |
ABM |
1.0 ml |
EUR 2333 |
Ap1g1 3'UTR Luciferase Stable Cell Line |
|
TU101902 |
ABM |
1.0 ml |
Ask for price |
 AP1G1 3'UTR GFP Stable Cell Line |
|
TU050902 |
ABM |
1.0 ml |
EUR 2333 |
Ap1g1 3'UTR GFP Stable Cell Line |
|
TU250712 |
ABM |
1.0 ml |
Ask for price |
 Antibody) Adaptor Related Protein Complex 1 Gamma 1 Subunit (AP1G1) Antibody |
|
20-abx110823 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Adaptor Related Protein Complex 1 Gamma 1 Subunit (AP1G1) Antibody |
|
20-abx212174 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 (CMV) (pLenti-GIII-CMV)) AP1G1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV626767 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (UbC) (pLenti-GIII-UbC)) AP1G1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV626771 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (EF1a) (pLenti-GIII-EF1a)) AP1G1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV626772 |
ABM |
1.0 ug DNA |
EUR 1355 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
AP1G1 Rabbit Polyclonal Antibody
