AP1G1 Rabbit Polyclonal Antibody

AP1G1 Rabbit Polyclonal Antibody

AP1G1 Polyclonal Antibody

ABP57782-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AP1G1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of AP1G1 from Human, Mouse. This AP1G1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP1G1 protein

AP1G1 Polyclonal Antibody

ABP57782-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AP1G1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of AP1G1 from Human, Mouse. This AP1G1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP1G1 protein

AP1G1 antibody

70R-3825 50 ug
EUR 467
Description: Rabbit polyclonal AP1G1 antibody raised against the C terminal of AP1G1

AP1G1 Antibody

36741-100ul 100ul
EUR 252

AP1G1 antibody

70R-15746 50 ul
EUR 435
Description: Rabbit polyclonal AP1G1 antibody

AP1G1 Antibody

1-CSB-PA001861GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

AP1G1 Antibody

1-CSB-PA001861LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

AP1G1 Antibody

1-CSB-PA248283
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

Polyclonal AP1G1 antibody - C-terminal region

APR14953G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AP1G1 - C-terminal region. This antibody is tested and proven to work in the following applications:

AP1G1 Conjugated Antibody

C36741 100ul
EUR 397

Anti-AP1G1 Antibody

A12998 100ug
EUR 432
Description: Goat Polyclonal AP1G1 Antibody. Validated in IP, WB and tested in Human.

Anti-AP1G1 antibody

STJ192028 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AP1G1

AP1G1 siRNA

20-abx907703
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AP1G1 siRNA

20-abx907704
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AP1G1 Antibody, HRP conjugated

1-CSB-PA001861LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AP1G1 Antibody, FITC conjugated

1-CSB-PA001861LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AP1G1 Antibody, Biotin conjugated

1-CSB-PA001861LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP1G1. Recognizes AP1G1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal AP1G1 / Adaptin Gamma 1 Antibody (aa646-659)

APR14968G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AP1G1 / Adaptin Gamma 1 (aa646-659). This antibody is tested and proven to work in the following applications:

AP1G1 Blocking Peptide

33R-1979 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AP1G1 antibody, catalog no. 70R-3825

AP1G1 cloning plasmid

CSB-CL001861HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2478
  • Sequence: atgccagcccccatcagattgcgggagctgatccggaccatccggacagcccgaacccaagctgaagaacgagaaatgatccagaaagaatgtgctgcaatccggtcatcttttagagaagaagacaatacataccgatgtcggaatgtggcaaaattactgtatatgcacatgc
  • Show more
Description: A cloning plasmid for the AP1G1 gene.

Human AP1G1 shRNA Plasmid

20-abx950118
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AP1G1 shRNA Plasmid

20-abx969158
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AP1G1 Recombinant Protein (Human)

RP001405 100 ug Ask for price

AP1G1 Recombinant Protein (Rat)

RP190406 100 ug Ask for price

AP1G1 Recombinant Protein (Mouse)

RP116213 100 ug Ask for price

AP1G1 ORF Vector (Human) (pORF)

ORF000469 1.0 ug DNA
EUR 95

Ap1g1 ORF Vector (Mouse) (pORF)

ORF038739 1.0 ug DNA
EUR 506

Ap1g1 ORF Vector (Rat) (pORF)

ORF063470 1.0 ug DNA
EUR 506

Rabbit AP 1 complex subunit gamma 1(AP1G1) ELISA kit

E04A1555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AP 1 complex subunit gamma 1(AP1G1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AP 1 complex subunit gamma 1(AP1G1) ELISA kit

E04A1555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AP 1 complex subunit gamma 1(AP1G1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AP 1 complex subunit gamma 1(AP1G1) ELISA kit

E04A1555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AP 1 complex subunit gamma 1(AP1G1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AP-1 Complex Subunit Gamma-1 (AP1G1) Antibody

abx037674-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

AP-1 Complex Subunit Gamma-1 (AP1G1) Antibody

abx038309-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

AP-1 Complex Subunit Gamma-1 (AP1G1) Antibody

20-abx318266
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

AP1G1 sgRNA CRISPR Lentivector set (Human)

K0099601 3 x 1.0 ug
EUR 339

Ap1g1 sgRNA CRISPR Lentivector set (Mouse)

K4761501 3 x 1.0 ug
EUR 339

Ap1g1 sgRNA CRISPR Lentivector set (Rat)

K7122401 3 x 1.0 ug
EUR 339

AP1G1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0099602 1.0 ug DNA
EUR 154

AP1G1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0099603 1.0 ug DNA
EUR 154

AP1G1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0099604 1.0 ug DNA
EUR 154

Ap1g1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4761502 1.0 ug DNA
EUR 154

Ap1g1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4761503 1.0 ug DNA
EUR 154

Ap1g1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4761504 1.0 ug DNA
EUR 154

Ap1g1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7122402 1.0 ug DNA
EUR 154

Ap1g1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7122403 1.0 ug DNA
EUR 154

Ap1g1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7122404 1.0 ug DNA
EUR 154

AP1G1 Protein Vector (Human) (pPB-C-His)

PV001873 500 ng
EUR 329

AP1G1 Protein Vector (Human) (pPB-N-His)

PV001874 500 ng
EUR 329

AP1G1 Protein Vector (Human) (pPM-C-HA)

PV001875 500 ng
EUR 329

AP1G1 Protein Vector (Human) (pPM-C-His)

PV001876 500 ng
EUR 329

AP1G1 Protein Vector (Mouse) (pPB-C-His)

PV154954 500 ng
EUR 1065

AP1G1 Protein Vector (Mouse) (pPB-N-His)

PV154955 500 ng
EUR 1065

AP1G1 Protein Vector (Mouse) (pPM-C-HA)

PV154956 500 ng
EUR 1065

AP1G1 Protein Vector (Mouse) (pPM-C-His)

PV154957 500 ng
EUR 1065

AP1G1 Protein Vector (Human) (pPB-His-MBP)

PV322510 500 ng
EUR 329

AP1G1 Protein Vector (Human) (pPB-His-GST)

PV322511 500 ng
EUR 329

AP1G1 Protein Vector (Rat) (pPB-C-His)

PV253878 500 ng
EUR 1166

AP1G1 Protein Vector (Rat) (pPB-N-His)

PV253879 500 ng
EUR 1166

AP1G1 Protein Vector (Rat) (pPM-C-HA)

PV253880 500 ng
EUR 1166

AP1G1 Protein Vector (Rat) (pPM-C-His)

PV253881 500 ng
EUR 1166

Ap1g1 3'UTR Luciferase Stable Cell Line

TU200712 1.0 ml Ask for price

Ap1g1 3'UTR GFP Stable Cell Line

TU151902 1.0 ml Ask for price

AP1G1 3'UTR Luciferase Stable Cell Line

TU000902 1.0 ml
EUR 2333

Ap1g1 3'UTR Luciferase Stable Cell Line

TU101902 1.0 ml Ask for price

AP1G1 3'UTR GFP Stable Cell Line

TU050902 1.0 ml
EUR 2333

Ap1g1 3'UTR GFP Stable Cell Line

TU250712 1.0 ml Ask for price

Adaptor Related Protein Complex 1 Gamma 1 Subunit (AP1G1) Antibody

20-abx110823
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adaptor Related Protein Complex 1 Gamma 1 Subunit (AP1G1) Antibody

20-abx212174
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

AP1G1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV626767 1.0 ug DNA
EUR 1355

AP1G1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV626771 1.0 ug DNA
EUR 1355

AP1G1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV626772 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

AP1G1 Rabbit Polyclonal Antibody