APOA2 Rabbit Polyclonal Antibody

APOA2 Rabbit Polyclonal Antibody

APOA2 Polyclonal Antibody

ES10843-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against APOA2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-Hu-48T 48T
EUR 479
  • Should the Human Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Human Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-Hu-96T 96T
EUR 621
  • Should the Human Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-Mu-48T 48T
EUR 489
  • Should the Mouse Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-Mu-96T 96T
EUR 635
  • Should the Mouse Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Porcine Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-p-48T 48T
EUR 547
  • Should the Porcine Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Porcine Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-p-96T 96T
EUR 715
  • Should the Porcine Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Rat Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-Ra-48T 48T
EUR 508
  • Should the Rat Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Rat Apolipoprotein A2 (APOA2) ELISA Kit

DLR-APOA2-Ra-96T 96T
EUR 661
  • Should the Rat Apolipoprotein A2 (APOA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A2 (APOA2) in samples from serum, plasma or other biological fluids.

Human Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-Hu-48Tests 48 Tests
EUR 500

Human Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-Hu-96Tests 96 Tests
EUR 692

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-Mu-48Tests 48 Tests
EUR 511

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-Mu-96Tests 96 Tests
EUR 709

Porcine Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-p-48Tests 48 Tests
EUR 580

Porcine Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-p-96Tests 96 Tests
EUR 807

Rat Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-Ra-48Tests 48 Tests
EUR 534

Rat Apolipoprotein A2 (APOA2) ELISA Kit

RDR-APOA2-Ra-96Tests 96 Tests
EUR 742

Human Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-Hu-48Tests 48 Tests
EUR 478

Human Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-Hu-96Tests 96 Tests
EUR 662

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-Mu-48Tests 48 Tests
EUR 489

Mouse Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-Mu-96Tests 96 Tests
EUR 677

Porcine Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-p-48Tests 48 Tests
EUR 555

Porcine Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-p-96Tests 96 Tests
EUR 771

Rat Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-Ra-48Tests 48 Tests
EUR 511

Rat Apolipoprotein A2 (APOA2) ELISA Kit

RD-APOA2-Ra-96Tests 96 Tests
EUR 709

APOA2 Rabbit pAb

A14690-100ul 100 ul
EUR 308

APOA2 Rabbit pAb

A14690-200ul 200 ul
EUR 459

APOA2 Rabbit pAb

A14690-20ul 20 ul
EUR 183

APOA2 Rabbit pAb

A14690-50ul 50 ul
EUR 223

APOA2 Rabbit pAb

A1711-100ul 100 ul
EUR 308

APOA2 Rabbit pAb

A1711-200ul 200 ul
EUR 459

APOA2 Rabbit pAb

A1711-20ul 20 ul Ask for price

APOA2 Rabbit pAb

A1711-50ul 50 ul Ask for price

Rabbit APOA2 ELISA Kit

ERTA0517 96Tests
EUR 521

APOA2 Antibody

45172-100ul 100ul
EUR 252

APOA2 Antibody

45172-50ul 50ul
EUR 187

APOA2 Antibody

1-CSB-PA001915GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: liquid
  • Buffer: PBS with 0.1% sodium azide and 50% glycerol pH 7.3. Antigen Affinity purified
Description: A polyclonal antibody against APOA2. Recognizes APOA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

APOA2 Antibody

DF7905 200ul
EUR 304
Description: APOA2 Antibody detects endogenous levels of total APOA2.

APOA2 Antibody

ABD7905 100 ug
EUR 438

APOA2 Antibody

ABD7912 100 ug
EUR 438

Polyclonal APOA2 / Apolipoprotein A II Antibody

APG01944G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human APOA2 / Apolipoprotein A II . This antibody is tested and proven to work in the following applications:

Polyclonal APOA2 / Apolipoprotein A II Antibody

APG01945G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human APOA2 / Apolipoprotein A II . This antibody is tested and proven to work in the following applications:

Polyclonal APOA2 / Apolipoprotein A II Antibody

APG01946G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human APOA2 / Apolipoprotein A II . This antibody is tested and proven to work in the following applications:

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human)

4-PAA604Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2)

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig)

4-PAA604Po01
  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2)

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat)

4-PAA604Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2)

APOA2 Conjugated Antibody

C45172 100ul
EUR 397

Anti-APOA2 antibody

STJ111107 100 µl
EUR 277
Description: This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia.

Anti-APOA2 antibody

STJ118047 100 µl
EUR 277

Anti-APOA2 antibody

STJ192001 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to APOA2

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), APC

4-PAA604Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with APC.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), Biotinylated

4-PAA604Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with Biotin.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), Cy3

4-PAA604Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with Cy3.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), FITC

4-PAA604Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with FITC.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), HRP

4-PAA604Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with HRP.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), PE

4-PAA604Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with PE.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), APC

4-PAA604Po01-APC
  • EUR 363.00
  • EUR 3527.00
  • EUR 975.00
  • EUR 465.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with APC.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), Biotinylated

4-PAA604Po01-Biotin
  • EUR 324.00
  • EUR 2644.00
  • EUR 773.00
  • EUR 399.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with Biotin.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), Cy3

4-PAA604Po01-Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with Cy3.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), FITC

4-PAA604Po01-FITC
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with FITC.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), HRP

4-PAA604Po01-HRP
  • EUR 331.00
  • EUR 3073.00
  • EUR 862.00
  • EUR 419.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with HRP.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), PE

4-PAA604Po01-PE
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with PE.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), APC

4-PAA604Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with APC.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), Biotinylated

4-PAA604Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with Biotin.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), Cy3

4-PAA604Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with Cy3.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), FITC

4-PAA604Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with FITC.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), HRP

4-PAA604Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with HRP.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), PE

4-PAA604Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with PE.

Rabbit Apolipoprotein A2 (APOA2) ELISA Kit

abx363450-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

ApoA2 protein

30-1048 100 ug
EUR 382
Description: Purified native Human ApoA2 protein

APOA2 siRNA

20-abx900371
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

APOA2 Protein

20-abx263100
  • EUR 328.00
  • EUR 1247.00
  • EUR 230.00
  • 100 ug
  • 1 mg
  • 20 ug
  • Shipped within 5-10 working days.

APOA2 siRNA

20-abx907812
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

APOA2 siRNA

20-abx907813
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Apolipoprotein A2 (APOA2) Antibody

20-abx175422
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein A2 (APOA2) Antibody

20-abx175423
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein A2 (APOA2) Antibody

20-abx175424
  • EUR 1372.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein A2 (APOA2) Antibody

20-abx101702
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Apolipoprotein A2 (APOA2) Antibody

20-abx101703
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Apolipoprotein A2 (APOA2) Antibody

20-abx101704
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Apolipoprotein A2 (APOA2) Antibody

20-abx171267
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein A2 (APOA2) Antibody

20-abx171268
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein A2 (APOA2) Antibody

20-abx171269
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Apolipoprotein A2 (APOA2) Antibody

20-abx242863
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Human), APC-Cy7

4-PAA604Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Gln100)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Apolipoprotein A2 (APOA2). This antibody is labeled with APC-Cy7.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Pig), APC-Cy7

4-PAA604Po01-APC-Cy7
  • EUR 607.00
  • EUR 6934.00
  • EUR 1831.00
  • EUR 810.00
  • EUR 333.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Ala19~Gln100)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Apolipoprotein A2 (APOA2). This antibody is labeled with APC-Cy7.

Apolipoprotein A2 (APOA2) Polyclonal Antibody (Rat), APC-Cy7

4-PAA604Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: APOA2 (Gln24~Lys102)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Apolipoprotein A2 (APOA2). This antibody is labeled with APC-Cy7.

APOA2 Blocking Peptide

DF7905-BP 1mg
EUR 195

APOA2 cloning plasmid

CSB-CL001915HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 303
  • Sequence: atgaagctgctcgcagcaactgtgctactcctcaccatctgcagccttgaaggagctttggttcggagacaggcaaaggagccatgtgtggagagcctggtttctcagtacttccagaccgtgactgactatggcaaggacctgatggagaaggtcaagagcccagagcttcaggc
  • Show more
Description: A cloning plasmid for the APOA2 gene.

Apolipoprotein A-II (APOA2) Antibody

20-abx123469
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Apolipoprotein A-II (APOA2) Antibody

abx034964-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Apolipoprotein A-II (APOA2) Antibody

abx034964-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Apolipoprotein A-II (APOA2) Antibody

20-abx148240
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Apolipoprotein A2 (APOA2) Antibody (FITC)

20-abx271096
  • EUR 509.00
  • EUR 258.00
  • EUR 1511.00
  • EUR 704.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Apolipoprotein A2 (APOA2) Antibody (FITC)

20-abx271118
  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Apolipoprotein A2 (APOA2) Antibody (Biotin)

20-abx271361
  • EUR 481.00
  • EUR 244.00
  • EUR 1400.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Apolipoprotein A2 (APOA2) Antibody (Biotin)

20-abx271384
  • EUR 425.00
  • EUR 230.00
  • EUR 1191.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Apolipoprotein A2 (APOA2) Antibody Pair

20-abx370690
  • EUR 1595.00
  • EUR 1024.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Apolipoprotein A II (APOA2) Antibody

abx230507-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human APOA2 ELISA Kit

EHA0517 96Tests
EUR 521

APOA2 Rabbit Polyclonal Antibody