Da vinci european bio bank

CENPJ Rabbit Polyclonal Antibody

CENPJ Polyclonal Antibody
ABP58114-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human CENPJ protein at amino acid sequence of 510-590 Applications tips:
Description: A polyclonal antibody for detection of CENPJ from Human, Mouse. This CENPJ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CENPJ protein at amino acid sequence of 510-590

CENPJ Polyclonal Antibody
ES10523-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CENPJ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CENPJ Polyclonal Antibody
ES10523-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CENPJ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CENPJ Rabbit pAb
A8721-100ul	Abclonal	100 ul	EUR 308

CENPJ Rabbit pAb
A8721-200ul	Abclonal	200 ul	EUR 459

CENPJ Rabbit pAb
A8721-20ul	Abclonal	20 ul	EUR 183

CENPJ Rabbit pAb
A8721-50ul	Abclonal	50 ul	EUR 223

CENPJ antibody
70R-16351	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CENPJ antibody

CENPJ Antibody
36343-100ul	SAB	100ul	EUR 252

CENPJ Antibody
1-CSB-PA005213GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CENPJ. Recognizes CENPJ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

CENPJ Antibody
1-CSB-PA005213LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CENPJ. Recognizes CENPJ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:200-1:500

CENPJ Antibody
1-CSB-PA127200	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CENPJ. Recognizes CENPJ from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CENPJ Antibody
DF2312	Affbiotech	200ul	EUR 304
Description: CENPJ antibody detects endogenous levels of total CENPJ.

CENPJ Antibody
ABD2312	Lifescience Market	100 ug	EUR 438

CENPJ Polyclonal Antibody, HRP Conjugated
A69436	EpiGentek	100 ?g	EUR 628.55
Description: reagents widely cited

CENPJ Polyclonal Antibody, FITC Conjugated
A69437	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

CENPJ Polyclonal Antibody, Biotin Conjugated
A69438	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

CENPJ Conjugated Antibody
C36343	SAB	100ul	EUR 397

anti- CENPJ antibody
FNab01587	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:2000 IF: 1:10-1:100 Immunogen: centromere protein J Uniprot ID: Q9HC77 Gene ID: 55835 Research Area: Developmental biology
Description: Antibody raised against CENPJ

Anti-CENPJ antibody
PAab01587	Lifescience Market	100 ug	EUR 355

Anti-CENPJ antibody
STJ113581	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that belongs to the centromere protein family. During cell division, this protein plays a structural role in the maintenance of centrosome integrity and normal spindle morphology, and it is involved in microtubule disassembly at the centrosome. This protein can function as a transcriptional coactivator in the Stat5 signaling pathway, and also as a coactivator of NF-kappaB-mediated transcription, likely via its interaction with the coactivator p300/CREB-binding protein. Mutations in this gene are associated with primary autosomal recessive microcephaly, a disorder characterized by severely reduced brain size and mental retardation. Alternatively spliced transcript variants have been found for this gene.

Anti-CENPJ antibody
STJ191681	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CENPJ

Centromere Protein J (CENPJ) Polyclonal Antibody (Human)
4-PAC263Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asn207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ)

Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse)
4-PAC263Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asp204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ)

CENPJ siRNA
20-abx911455	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CENPJ siRNA
20-abx911456	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CENPJ
YF-PA19875	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CENPJ

anti-CENPJ
YF-PA19876	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to CENPJ

anti-CENPJ
YF-PA19877	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to CENPJ

anti-CENPJ
YF-PA26372	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to CENPJ

CENPJ Antibody, HRP conjugated
1-CSB-PA005213LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CENPJ. Recognizes CENPJ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CENPJ Antibody, FITC conjugated
1-CSB-PA005213LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CENPJ. Recognizes CENPJ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CENPJ Antibody, Biotin conjugated
1-CSB-PA005213LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CENPJ. Recognizes CENPJ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Centromere Protein J (CENPJ) Polyclonal Antibody (Human), APC
4-PAC263Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asn207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with APC.

Centromere Protein J (CENPJ) Polyclonal Antibody (Human), Biotinylated
4-PAC263Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asn207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with Biotin.

Centromere Protein J (CENPJ) Polyclonal Antibody (Human), Cy3
4-PAC263Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asn207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with Cy3.

Centromere Protein J (CENPJ) Polyclonal Antibody (Human), FITC
4-PAC263Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asn207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with FITC.

Centromere Protein J (CENPJ) Polyclonal Antibody (Human), HRP
4-PAC263Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asn207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with HRP.

Centromere Protein J (CENPJ) Polyclonal Antibody (Human), PE
4-PAC263Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asn207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with PE.

Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), APC
4-PAC263Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asp204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with APC.

Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), Biotinylated
4-PAC263Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asp204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with Biotin.

Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), Cy3
4-PAC263Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asp204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with Cy3.

Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), FITC
4-PAC263Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asp204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with FITC.

Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), HRP
4-PAC263Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asp204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with HRP.

Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), PE
4-PAC263Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asp204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with PE.

Rabbit Centromere protein J(CENPJ) ELISA kit
E04C0930-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Centromere protein J(CENPJ) ELISA kit
E04C0930-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Centromere protein J(CENPJ) ELISA kit
E04C0930-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CENPJ Blocking Peptide
DF2312-BP	Affbiotech	1mg	EUR 195

CENPJ cloning plasmid
CSB-CL005213HU-10ug	Cusabio	10ug	EUR 1581
Formulation: 10 μg plasmid + 200μl Glycerol Length: 4017 Sequence: atgttcctgatgccaacctcttcagagttaaacagtgggcagaacttcctaacccagtggatgaccaatccttctcgggctggggtcatattaaatcgtggatttcctattttggaagcagacaaagagaagcgagcagctgtggacatttctaccagctttcctattaaaggca Show more
Description: A cloning plasmid for the CENPJ gene.

Anti-CENPJ (5D5)
YF-MA11574	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CENPJ

Anti-CENPJ (5D5)
YF-MA18848	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to CENPJ

Anti-CENPJ (1A5)
YF-MA18849	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to CENPJ

Anti-CENPJ (1A5)
YF-MA18850	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to CENPJ

Centromere Protein J (CENPJ) Antibody
20-abx211551	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Centromere Protein J (CENPJ) Antibody
20-abx111544	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Centromere Protein J (CENPJ) Antibody
20-abx124205	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Centromere Protein J (CENPJ) Antibody
20-abx131252	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Centromere Protein J (CENPJ) Antibody
20-abx131253	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Centromere Protein J (CENPJ) Antibody
20-abx338370	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Centromere Protein J (CENPJ) Antibody
abx231587-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Centromere Protein J (CENPJ) Polyclonal Antibody (Human), APC-Cy7
4-PAC263Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asn207) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with APC-Cy7.

Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC263Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CENPJ (Met1~Asp204) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with APC-Cy7.

Centromere Protein J (CENPJ) Antibody (HRP)
20-abx335049	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Centromere Protein J (CENPJ) Antibody (FITC)
20-abx335050	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Centromere Protein J (CENPJ) Antibody (Biotin)
20-abx335051	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human CENPJ shRNA Plasmid
20-abx960958	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CENPJ shRNA Plasmid
20-abx981232	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Cenpj ORF Vector (Rat) (pORF)
ORF064848	ABM	1.0 ug DNA	EUR 506

CENPJ ORF Vector (Human) (pORF)
ORF012665	ABM	1.0 ug DNA	EUR 354

Cenpj ORF Vector (Mouse) (pORF)
ORF041163	ABM	1.0 ug DNA	EUR 1572

Recombinant Centromere Protein J (CENPJ)
4-RPC263Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9HC77 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Centromere Protein J expressed in: E.coli

Recombinant Centromere Protein J (CENPJ)
4-RPC263Mu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q569L8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Mouse Centromere Protein J expressed in: E.coli

Human Centromere Protein J (CENPJ) Protein
20-abx168856	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Centromere Protein J (CENPJ) Protein
20-abx168857	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CENPJ sgRNA CRISPR Lentivector set (Human)
K0432401	ABM	3 x 1.0 ug	EUR 339

Cenpj sgRNA CRISPR Lentivector set (Mouse)
K4810801	ABM	3 x 1.0 ug	EUR 339

Cenpj sgRNA CRISPR Lentivector set (Rat)
K6400901	ABM	3 x 1.0 ug	EUR 339

Human Centromere protein J(CENPJ) ELISA kit
E01C0930-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Centromere protein J(CENPJ) ELISA kit
E01C0930-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Centromere protein J(CENPJ) ELISA kit
E01C0930-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Centromere protein J(CENPJ) ELISA kit
E06C0930-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Centromere protein J(CENPJ) ELISA kit
E06C0930-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Centromere protein J(CENPJ) ELISA kit
E06C0930-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Centromere protein J(CENPJ) ELISA kit
E03C0930-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Centromere protein J(CENPJ) ELISA kit
E03C0930-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Centromere protein J(CENPJ) ELISA kit
E03C0930-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Centromere protein J(CENPJ) ELISA kit
E02C0930-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Centromere protein J(CENPJ) ELISA kit
E02C0930-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Centromere protein J(CENPJ) ELISA kit
E02C0930-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Centromere protein J(CENPJ) ELISA kit
E09C0930-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Centromere protein J(CENPJ) ELISA kit
E09C0930-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Centromere protein J(CENPJ) ELISA kit
E09C0930-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Centromere protein J(CENPJ) ELISA kit
E08C0930-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Centromere protein J(CENPJ) ELISA kit
E08C0930-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Centromere protein J(CENPJ) ELISA kit
E08C0930-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Centromere protein J(CENPJ) ELISA kit
E07C0930-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Centromere protein J(CENPJ) ELISA kit
E07C0930-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Centromere protein J(CENPJ) ELISA kit
E07C0930-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Centromere protein J, Cenpj ELISA KIT
ELI-11051m	Lifescience Market	96 Tests	EUR 865

Human Centromere protein J, CENPJ ELISA KIT
ELI-25720h	Lifescience Market	96 Tests	EUR 824

CENPJ sgRNA CRISPR Lentivector (Human) (Target 1)
K0432402	ABM	1.0 ug DNA	EUR 154

CENPJ sgRNA CRISPR Lentivector (Human) (Target 2)
K0432403	ABM	1.0 ug DNA	EUR 154

CENPJ sgRNA CRISPR Lentivector (Human) (Target 3)
K0432404	ABM	1.0 ug DNA	EUR 154

Cenpj sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4810802	ABM	1.0 ug DNA	EUR 154

Cenpj sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4810803	ABM	1.0 ug DNA	EUR 154

Cenpj sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4810804	ABM	1.0 ug DNA	EUR 154

Cenpj sgRNA CRISPR Lentivector (Rat) (Target 1)
K6400902	ABM	1.0 ug DNA	EUR 154

Cenpj sgRNA CRISPR Lentivector (Rat) (Target 2)
K6400903	ABM	1.0 ug DNA	EUR 154

Cenpj sgRNA CRISPR Lentivector (Rat) (Target 3)
K6400904	ABM	1.0 ug DNA	EUR 154

CENPJ Protein Vector (Mouse) (pPB-C-His)
PV164650	ABM	500 ng	EUR 2300

CENPJ Protein Vector (Mouse) (pPB-N-His)
PV164651	ABM	500 ng	EUR 2300

CENPJ Protein Vector (Mouse) (pPM-C-HA)
PV164652	ABM	500 ng	EUR 2300

CENPJ Protein Vector (Mouse) (pPM-C-His)
PV164653	ABM	500 ng	EUR 2300

CENPJ Protein Vector (Rat) (pPB-C-His)
PV259390	ABM	500 ng	EUR 1191

CENPJ Protein Vector (Rat) (pPB-N-His)
PV259391	ABM	500 ng	EUR 1191

CENPJ Protein Vector (Rat) (pPM-C-HA)
PV259392	ABM	500 ng	EUR 1191

CENPJ Protein Vector (Rat) (pPM-C-His)
PV259393	ABM	500 ng	EUR 1191

CENPJ Protein Vector (Human) (pPB-C-His)
PV050657	ABM	500 ng	EUR 481

CENPJ Protein Vector (Human) (pPB-N-His)
PV050658	ABM	500 ng	EUR 481

CENPJ Protein Vector (Human) (pPM-C-HA)
PV050659	ABM	500 ng	EUR 481

CENPJ Protein Vector (Human) (pPM-C-His)
PV050660	ABM	500 ng	EUR 481

Cenpj 3'UTR GFP Stable Cell Line
TU153718	ABM	1.0 ml	Ask for price

Cenpj 3'UTR Luciferase Stable Cell Line
TU103718	ABM	1.0 ml	Ask for price

Cenpj 3'UTR Luciferase Stable Cell Line
TU202174	ABM	1.0 ml	Ask for price

Cenpj 3'UTR GFP Stable Cell Line
TU252174	ABM	1.0 ml	Ask for price

CENPJ 3'UTR GFP Stable Cell Line
TU054222	ABM	1.0 ml	EUR 1394

CENPJ 3'UTR Luciferase Stable Cell Line
TU004222	ABM	1.0 ml	EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

CENPJ Rabbit Polyclonal Antibody