Da vinci european bio bank

CIRBP Rabbit Polyclonal Antibody

CIRBP Polyclonal Antibody
ABP58158-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human CIRBP protein Applications tips:
Description: A polyclonal antibody for detection of CIRBP from Human, Mouse, Rat. This CIRBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CIRBP protein

CIRBP Rabbit pAb
A6080-100ul	Abclonal	100 ul	EUR 308

CIRBP Rabbit pAb
A6080-200ul	Abclonal	200 ul	EUR 459

CIRBP Rabbit pAb
A6080-20ul	Abclonal	20 ul	EUR 183

CIRBP Rabbit pAb
A6080-50ul	Abclonal	50 ul	EUR 223

CIRBP Rabbit pAb
A6559-100ul	Abclonal	100 ul	EUR 308

CIRBP Rabbit pAb
A6559-200ul	Abclonal	200 ul	EUR 459

CIRBP Rabbit pAb
A6559-20ul	Abclonal	20 ul	EUR 183

CIRBP Rabbit pAb
A6559-50ul	Abclonal	50 ul	EUR 223

Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RD-CIRBP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RD-CIRBP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RDR-CIRBP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RDR-CIRBP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Rat CIRBP(CIRBP)
QY-E11680	Qayee Biotechnology	96T	EUR 374

Polyclonal CIRBP Antibody (C-term)
APR06147G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CIRBP (C-term). This antibody is tested and proven to work in the following applications:

CIRBP antibody
70R-5012	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CIRBP antibody raised against the N terminal of CIRBP

CIRBP antibody
70R-4931	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CIRBP antibody raised against the middle region of CIRBP

CIRBP Antibody
ABD2643	Lifescience Market	100 ug	EUR 438

CIRBP antibody
39007-100ul	SAB	100ul	EUR 252

CIRBP Antibody
46954-100ul	SAB	100ul	EUR 252

CIRBP antibody
70R-16426	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CIRBP antibody

CIRBP Antibody
DF2643	Affbiotech	200ul	EUR 304
Description: CIRBP antibody detects endogenous levels of total CIRBP.

CIRBP Antibody
1-CSB-PA005440GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CIRBP. Recognizes CIRBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CIRBP Antibody
1-CSB-PA613483DSR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CIRBP. Recognizes CIRBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal CIRP / CIRBP Antibody (aa161-172)
APG01188G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRP / CIRBP (aa161-172). This antibody is tested and proven to work in the following applications:

CIRBP Conjugated Antibody
C39007	SAB	100ul	EUR 397

anti- CIRBP antibody
FNab01715	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:100 IF: 1:10 - 1:100 Immunogen: cold inducible RNA binding protein Uniprot ID: Q14011 Gene ID: 1153 Research Area: Cell Division and Proliferation, Metabolism
Description: Antibody raised against CIRBP

CIRBP Antibody (Biotin)
abx431162-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Anti-CIRBP antibody
PAab01715	Lifescience Market	100 ug	EUR 386

Anti-CIRBP antibody
STJ28642	St John's Laboratory	100 µl	EUR 277

Anti-CIRBP antibody
STJ113565	St John's Laboratory	100 µl	EUR 277

Anti-CIRBP antibody
STJ191955	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CIRBP

CIRBP siRNA
20-abx901080	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CIRBP siRNA
20-abx911879	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CIRBP siRNA
20-abx911880	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CIRBP
YF-PA10960	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to CIRBP

Polyclonal CIRBP (aa 81-91) Antibody (internal region)
APG00688G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRBP (aa 81-91) (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal CIRBP (aa 161-172) Antibody (C-Term)
APG00689G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRBP (aa 161-172) (C-Term). This antibody is tested and proven to work in the following applications:

CIRBP cloning plasmid
CSB-CL613483HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 519 Sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacga Show more
Description: A cloning plasmid for the CIRBP gene.

CIRBP cloning plasmid
CSB-CL613483HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 519 Sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacga Show more
Description: A cloning plasmid for the CIRBP gene.

CIRBP Blocking Peptide
33R-3676	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CIRBP antibody, catalog no. 70R-4931

CIRBP Blocking Peptide
33R-5739	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CIRBP antibody, catalog no. 70R-5012

CIRBP Blocking Peptide
DF2643-BP	Affbiotech	1mg	EUR 195

pCMV-SPORT6-CIRBP
PVT12397	Lifescience Market	2 ug	EUR 391

Anti-CIRBP (1C9)
YF-MA12456	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CIRBP

Anti-CIRBP (aa 81-91) antibody
STJ72321	St John's Laboratory	100 µg	EUR 359

Anti-CIRBP (aa 161-172) antibody
STJ72322	St John's Laboratory	100 µg	EUR 359

Rat CIRBP shRNA Plasmid
20-abx986740	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CIRBP ELISA Kit
ELA-E12931h	Lifescience Market	96 Tests	EUR 824

CIRBP ELISA KIT|Human
EF005111	Lifescience Market	96 Tests	EUR 689

Human CIRBP shRNA Plasmid
20-abx950827	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CIRBP protein (His tag)
80R-1790	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human CIRBP protein

Mouse CIRBP shRNA Plasmid
20-abx969680	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CIRBP Recombinant Protein (Human)
RP007156	ABM	100 ug	Ask for price

CIRBP Rabbit Polyclonal Antibody