CIRBP Rabbit Polyclonal Antibody

CIRBP Rabbit Polyclonal Antibody

CIRBP Polyclonal Antibody
ES10797-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CIRBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CIRBP Rabbit pAb
A6559-100ul 100 ul
EUR 308
CIRBP Rabbit pAb
A6559-200ul 200 ul
EUR 459
CIRBP Rabbit pAb
A6559-20ul 20 ul
EUR 183
CIRBP Rabbit pAb
A6559-50ul 50 ul
EUR 223
CIRBP Rabbit pAb
A6080-100ul 100 ul
EUR 308
CIRBP Rabbit pAb
A6080-200ul 200 ul
EUR 459
CIRBP Rabbit pAb
A6080-20ul 20 ul
EUR 183
CIRBP Rabbit pAb
A6080-50ul 50 ul
EUR 223
Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RDR-CIRBP-Hu-48Tests 48 Tests
EUR 544
Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RDR-CIRBP-Hu-96Tests 96 Tests
EUR 756
Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RD-CIRBP-Hu-48Tests 48 Tests
EUR 521
Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RD-CIRBP-Hu-96Tests 96 Tests
EUR 723
Rat CIRBP(CIRBP)
QY-E11680 96T
EUR 374
Polyclonal CIRBP Antibody (C-term)
APR06147G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CIRBP (C-term). This antibody is tested and proven to work in the following applications:
CIRBP antibody
70R-16426 50 ul
EUR 435
Description: Rabbit polyclonal CIRBP antibody
CIRBP Antibody
46954-100ul 100ul
EUR 252
CIRBP antibody
39007-100ul 100ul
EUR 252
CIRBP Antibody
1-CSB-PA005440GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CIRBP. Recognizes CIRBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CIRBP Antibody
1-CSB-PA613483DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CIRBP. Recognizes CIRBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA
CIRBP Antibody
DF2643 200ul
EUR 304
Description: CIRBP antibody detects endogenous levels of total CIRBP.
CIRBP antibody
70R-4931 50 ug
EUR 467
Description: Rabbit polyclonal CIRBP antibody raised against the middle region of CIRBP
CIRBP antibody
70R-5012 50 ug
EUR 467
Description: Rabbit polyclonal CIRBP antibody raised against the N terminal of CIRBP
CIRBP Antibody
ABD2643 100 ug
EUR 438
Polyclonal CIRP / CIRBP Antibody (aa161-172)
APG01188G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRP / CIRBP (aa161-172). This antibody is tested and proven to work in the following applications:
CIRBP Conjugated Antibody
C39007 100ul
EUR 397
CIRBP Antibody (Biotin)
abx431162-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
anti- CIRBP antibody
FNab01715 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • IF: 1:10 - 1:100
  • Immunogen: cold inducible RNA binding protein
  • Uniprot ID: Q14011
  • Gene ID: 1153
  • Research Area: Cell Division and Proliferation, Metabolism
Description: Antibody raised against CIRBP
Anti-CIRBP antibody
PAab01715 100 ug
EUR 386
Anti-CIRBP antibody
STJ28642 100 µl
EUR 277
Anti-CIRBP antibody
STJ113565 100 µl
EUR 277
Anti-CIRBP antibody
STJ191955 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CIRBP
CIRBP siRNA
20-abx901080
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CIRBP siRNA
20-abx911879
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CIRBP siRNA
20-abx911880
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-CIRBP
YF-PA10960 100 ug
EUR 403
Description: Rabbit polyclonal to CIRBP
Polyclonal CIRBP (aa 81-91) Antibody (internal region)
APG00688G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRBP (aa 81-91) (internal region). This antibody is tested and proven to work in the following applications:
Polyclonal CIRBP (aa 161-172) Antibody (C-Term)
APG00689G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRBP (aa 161-172) (C-Term). This antibody is tested and proven to work in the following applications:
CIRBP Blocking Peptide
33R-3676 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CIRBP antibody, catalog no. 70R-4931
CIRBP Blocking Peptide
33R-5739 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CIRBP antibody, catalog no. 70R-5012
CIRBP Blocking Peptide
DF2643-BP 1mg
EUR 195
CIRBP cloning plasmid
CSB-CL613483HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacga
  • Show more
Description: A cloning plasmid for the CIRBP gene.
CIRBP cloning plasmid
CSB-CL613483HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacga
  • Show more
Description: A cloning plasmid for the CIRBP gene.
pCMV-SPORT6-CIRBP
PVT12397 2 ug
EUR 391
Anti-CIRBP (1C9)
YF-MA12456 100 ug
EUR 363
Description: Mouse monoclonal to CIRBP
Anti-CIRBP (aa 81-91) antibody
STJ72321 100 µg
EUR 359
Anti-CIRBP (aa 161-172) antibody
STJ72322 100 µg
EUR 359
CIRBP protein (His tag)
80R-1790 100 ug
EUR 305
Description: Purified recombinant Human CIRBP protein
Human CIRBP ELISA Kit
ELA-E12931h 96 Tests
EUR 824
CIRBP ELISA KIT|Human
EF005111 96 Tests
EUR 689
Rat CIRBP shRNA Plasmid
20-abx986740
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CIRBP shRNA Plasmid
20-abx969680
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CIRBP shRNA Plasmid
20-abx950827
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pECMV-3-FLAG-CIRBP
PVT12996 2 ug
EUR 325

CIRBP Rabbit Polyclonal Antibody