CIRBP Rabbit Polyclonal Antibody

CIRBP Rabbit Polyclonal Antibody

CIRBP Polyclonal Antibody
ABP58158-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CIRBP protein
  • Applications tips:
Description: A polyclonal antibody for detection of CIRBP from Human, Mouse, Rat. This CIRBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CIRBP protein
CIRBP Rabbit pAb
A6080-100ul 100 ul
EUR 308
CIRBP Rabbit pAb
A6080-200ul 200 ul
EUR 459
CIRBP Rabbit pAb
A6080-20ul 20 ul
EUR 183
CIRBP Rabbit pAb
A6080-50ul 50 ul
EUR 223
CIRBP Rabbit pAb
A6559-100ul 100 ul
EUR 308
CIRBP Rabbit pAb
A6559-200ul 200 ul
EUR 459
CIRBP Rabbit pAb
A6559-20ul 20 ul
EUR 183
CIRBP Rabbit pAb
A6559-50ul 50 ul
EUR 223
Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RD-CIRBP-Hu-48Tests 48 Tests
EUR 521
Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RD-CIRBP-Hu-96Tests 96 Tests
EUR 723
Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RDR-CIRBP-Hu-48Tests 48 Tests
EUR 544
Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RDR-CIRBP-Hu-96Tests 96 Tests
EUR 756
Rat CIRBP(CIRBP)
QY-E11680 96T
EUR 374
Polyclonal CIRBP Antibody (C-term)
APR06147G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CIRBP (C-term). This antibody is tested and proven to work in the following applications:
CIRBP antibody
70R-5012 50 ug
EUR 467
Description: Rabbit polyclonal CIRBP antibody raised against the N terminal of CIRBP
CIRBP antibody
70R-4931 50 ug
EUR 467
Description: Rabbit polyclonal CIRBP antibody raised against the middle region of CIRBP
CIRBP Antibody
ABD2643 100 ug
EUR 438
CIRBP antibody
39007-100ul 100ul
EUR 252
CIRBP Antibody
46954-100ul 100ul
EUR 252
CIRBP antibody
70R-16426 50 ul
EUR 435
Description: Rabbit polyclonal CIRBP antibody
CIRBP Antibody
DF2643 200ul
EUR 304
Description: CIRBP antibody detects endogenous levels of total CIRBP.
CIRBP Antibody
1-CSB-PA005440GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CIRBP. Recognizes CIRBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CIRBP Antibody
1-CSB-PA613483DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CIRBP. Recognizes CIRBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA
Polyclonal CIRP / CIRBP Antibody (aa161-172)
APG01188G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRP / CIRBP (aa161-172). This antibody is tested and proven to work in the following applications:
CIRBP Conjugated Antibody
C39007 100ul
EUR 397
anti- CIRBP antibody
FNab01715 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • IF: 1:10 - 1:100
  • Immunogen: cold inducible RNA binding protein
  • Uniprot ID: Q14011
  • Gene ID: 1153
  • Research Area: Cell Division and Proliferation, Metabolism
Description: Antibody raised against CIRBP
CIRBP Antibody (Biotin)
abx431162-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Anti-CIRBP antibody
PAab01715 100 ug
EUR 386
Anti-CIRBP antibody
STJ28642 100 µl
EUR 277
Anti-CIRBP antibody
STJ113565 100 µl
EUR 277
Anti-CIRBP antibody
STJ191955 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CIRBP
CIRBP siRNA
20-abx901080
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CIRBP siRNA
20-abx911879
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CIRBP siRNA
20-abx911880
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-CIRBP
YF-PA10960 100 ug
EUR 403
Description: Rabbit polyclonal to CIRBP
Polyclonal CIRBP (aa 81-91) Antibody (internal region)
APG00688G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRBP (aa 81-91) (internal region). This antibody is tested and proven to work in the following applications:
Polyclonal CIRBP (aa 161-172) Antibody (C-Term)
APG00689G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRBP (aa 161-172) (C-Term). This antibody is tested and proven to work in the following applications:
CIRBP cloning plasmid
CSB-CL613483HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacga
  • Show more
Description: A cloning plasmid for the CIRBP gene.
CIRBP cloning plasmid
CSB-CL613483HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacga
  • Show more
Description: A cloning plasmid for the CIRBP gene.
CIRBP Blocking Peptide
33R-3676 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CIRBP antibody, catalog no. 70R-4931
CIRBP Blocking Peptide
33R-5739 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CIRBP antibody, catalog no. 70R-5012
CIRBP Blocking Peptide
DF2643-BP 1mg
EUR 195
pCMV-SPORT6-CIRBP
PVT12397 2 ug
EUR 391
Anti-CIRBP (1C9)
YF-MA12456 100 ug
EUR 363
Description: Mouse monoclonal to CIRBP
Anti-CIRBP (aa 81-91) antibody
STJ72321 100 µg
EUR 359
Anti-CIRBP (aa 161-172) antibody
STJ72322 100 µg
EUR 359
Rat CIRBP shRNA Plasmid
20-abx986740
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CIRBP ELISA Kit
ELA-E12931h 96 Tests
EUR 824
CIRBP ELISA KIT|Human
EF005111 96 Tests
EUR 689
Human CIRBP shRNA Plasmid
20-abx950827
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CIRBP protein (His tag)
80R-1790 100 ug
EUR 305
Description: Purified recombinant Human CIRBP protein
Mouse CIRBP shRNA Plasmid
20-abx969680
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CIRBP Recombinant Protein (Human)
RP007156 100 ug Ask for price

CIRBP Rabbit Polyclonal Antibody