CIRBP Rabbit Polyclonal Antibody

CIRBP Rabbit Polyclonal Antibody

CIRBP Polyclonal Antibody
ES10797-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CIRBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CIRBP Rabbit pAb
A6559-100ul	Abclonal	100 ul	EUR 308

CIRBP Rabbit pAb
A6559-200ul	Abclonal	200 ul	EUR 459

CIRBP Rabbit pAb
A6559-20ul	Abclonal	20 ul	EUR 183

CIRBP Rabbit pAb
A6559-50ul	Abclonal	50 ul	EUR 223

CIRBP Rabbit pAb
A6080-100ul	Abclonal	100 ul	EUR 308

CIRBP Rabbit pAb
A6080-200ul	Abclonal	200 ul	EUR 459

CIRBP Rabbit pAb
A6080-20ul	Abclonal	20 ul	EUR 183

CIRBP Rabbit pAb
A6080-50ul	Abclonal	50 ul	EUR 223

Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RDR-CIRBP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RDR-CIRBP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RD-CIRBP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Cold-Inducible RNA-Binding Protein (CIRBP) ELISA Kit
RD-CIRBP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat CIRBP(CIRBP)
QY-E11680	Qayee Biotechnology	96T	EUR 374

Polyclonal CIRBP Antibody (C-term)
APR06147G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CIRBP (C-term). This antibody is tested and proven to work in the following applications:

CIRBP antibody
70R-16426	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CIRBP antibody

CIRBP Antibody
46954-100ul	SAB	100ul	EUR 252

CIRBP antibody
39007-100ul	SAB	100ul	EUR 252

CIRBP Antibody
1-CSB-PA005440GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CIRBP. Recognizes CIRBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CIRBP Antibody
1-CSB-PA613483DSR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CIRBP. Recognizes CIRBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA

CIRBP Antibody
DF2643	Affbiotech	200ul	EUR 304
Description: CIRBP antibody detects endogenous levels of total CIRBP.

CIRBP antibody
70R-4931	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CIRBP antibody raised against the middle region of CIRBP

CIRBP antibody
70R-5012	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CIRBP antibody raised against the N terminal of CIRBP

CIRBP Antibody
ABD2643	Lifescience Market	100 ug	EUR 438

Polyclonal CIRP / CIRBP Antibody (aa161-172)
APG01188G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRP / CIRBP (aa161-172). This antibody is tested and proven to work in the following applications:

CIRBP Conjugated Antibody
C39007	SAB	100ul	EUR 397

CIRBP Antibody (Biotin)
abx431162-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

anti- CIRBP antibody
FNab01715	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:100 IF: 1:10 - 1:100 Immunogen: cold inducible RNA binding protein Uniprot ID: Q14011 Gene ID: 1153 Research Area: Cell Division and Proliferation, Metabolism
Description: Antibody raised against CIRBP

Anti-CIRBP antibody
PAab01715	Lifescience Market	100 ug	EUR 386

Anti-CIRBP antibody
STJ28642	St John's Laboratory	100 µl	EUR 277

Anti-CIRBP antibody
STJ113565	St John's Laboratory	100 µl	EUR 277

Anti-CIRBP antibody
STJ191955	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CIRBP

CIRBP siRNA
20-abx901080	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CIRBP siRNA
20-abx911879	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CIRBP siRNA
20-abx911880	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CIRBP
YF-PA10960	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to CIRBP

Polyclonal CIRBP (aa 81-91) Antibody (internal region)
APG00688G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRBP (aa 81-91) (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal CIRBP (aa 161-172) Antibody (C-Term)
APG00689G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CIRBP (aa 161-172) (C-Term). This antibody is tested and proven to work in the following applications:

CIRBP Blocking Peptide
33R-3676	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CIRBP antibody, catalog no. 70R-4931

CIRBP Blocking Peptide
33R-5739	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CIRBP antibody, catalog no. 70R-5012

CIRBP Blocking Peptide
DF2643-BP	Affbiotech	1mg	EUR 195

CIRBP cloning plasmid
CSB-CL613483HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 519 Sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacga Show more
Description: A cloning plasmid for the CIRBP gene.

CIRBP cloning plasmid
CSB-CL613483HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 519 Sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacga Show more
Description: A cloning plasmid for the CIRBP gene.

pCMV-SPORT6-CIRBP
PVT12397	Lifescience Market	2 ug	EUR 391

Anti-CIRBP (1C9)
YF-MA12456	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CIRBP

Anti-CIRBP (aa 81-91) antibody
STJ72321	St John's Laboratory	100 µg	EUR 359

Anti-CIRBP (aa 161-172) antibody
STJ72322	St John's Laboratory	100 µg	EUR 359

CIRBP protein (His tag)
80R-1790	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human CIRBP protein

Human CIRBP ELISA Kit
ELA-E12931h	Lifescience Market	96 Tests	EUR 824

CIRBP ELISA KIT|Human
EF005111	Lifescience Market	96 Tests	EUR 689

Rat CIRBP shRNA Plasmid
20-abx986740	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CIRBP shRNA Plasmid
20-abx969680	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CIRBP shRNA Plasmid
20-abx950827	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pECMV-3-FLAG-CIRBP
PVT12996	Lifescience Market	2 ug	EUR 325

CIRBP Rabbit Polyclonal Antibody