CPEB1 Rabbit Polyclonal Antibody

CPEB1 Rabbit Polyclonal Antibody

CPEB1 Polyclonal Antibody
ABP58252-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human CPEB1 protein at amino acid sequence of 230-310 Applications tips:
Description: A polyclonal antibody for detection of CPEB1 from Human, Mouse, Rat. This CPEB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CPEB1 protein at amino acid sequence of 230-310

Polyclonal CPEB1 Antibody
APR11650G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CPEB1 . This antibody is tested and proven to work in the following applications:

CPEB1 Polyclonal Antibody
A51233	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

CPEB1 Polyclonal Antibody
ES10644-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CPEB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CPEB1 Polyclonal Antibody
ES10644-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CPEB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CPEB1 Rabbit pAb
A5913-100ul	Abclonal	100 ul	EUR 308

CPEB1 Rabbit pAb
A5913-200ul	Abclonal	200 ul	EUR 459

CPEB1 Rabbit pAb
A5913-20ul	Abclonal	20 ul	EUR 183

CPEB1 Rabbit pAb
A5913-50ul	Abclonal	50 ul	EUR 223

CPEB1 Polyclonal Conjugated Antibody
C30672	SAB	100ul	EUR 397

CPEB1 Antibody
24716-100ul	SAB	100ul	EUR 390

CPEB1 antibody
70R-16553	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CPEB1 antibody

CPEB1 Antibody
35421-100ul	SAB	100ul	EUR 390

CPEB1 Antibody
1-CSB-PA005887GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CPEB1. Recognizes CPEB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CPEB1 Antibody
1-CSB-PA861184LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CPEB1. Recognizes CPEB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

CPEB1 Antibody
DF2462	Affbiotech	200ul	EUR 304
Description: CPEB1 antibody detects endogenous levels of total CPEB1.

CPEB1 Antibody
ABD2462	Lifescience Market	100 ug	EUR 438

Polyclonal Goat Anti-CPEB1 Antibody
APG03351G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CPEB1 . This antibody is tested and proven to work in the following applications:

Polyclonal CPEB1 Antibody (C-term)
APR11651G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CPEB1 (C-term). This antibody is tested and proven to work in the following applications:

CPEB1 Polyclonal Antibody, HRP Conjugated
A51234	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

CPEB1 Polyclonal Antibody, FITC Conjugated
A51235	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

CPEB1 Polyclonal Antibody, Biotin Conjugated
A51236	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

anti- CPEB1 antibody
FNab01917	FN Test	100µg	EUR 505.25
Immunogen: cytoplasmic polyadenylation element binding protein 1 Uniprot ID: Q9BZB8 Gene ID: 64506 Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against CPEB1

Anti-CPEB1 antibody
PAab01917	Lifescience Market	100 ug	EUR 355

Anti-CPEB1 antibody
STJ27709	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the cytoplasmic polyadenylation element binding protein family. This highly conserved protein binds to a specific RNA sequence, called the cytoplasmic polyadenylation element, found in the 3' untranslated region of some mRNAs. The encoded protein functions in both the cytoplasm and the nucleus. It is involved in the regulation of mRNA translation, as well as processing of the 3' untranslated region, and may play a role in cell proliferation and tumorigenesis. Alternative splicing results in multiple transcript variants.

Anti-CPEB1 antibody
STJ70558	St John's Laboratory	100 µg	EUR 359

Anti-CPEB1 antibody
STJ191802	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CPEB1

Cpeb1/ Rat Cpeb1 ELISA Kit
ELI-10505r	Lifescience Market	96 Tests	EUR 886

CPEB1 siRNA
20-abx901223	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CPEB1 siRNA
20-abx912650	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CPEB1 siRNA
20-abx912651	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CPEB1
YF-PA20555	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CPEB1

anti-CPEB1
YF-PA20556	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to CPEB1

CPEB1 Antibody, HRP conjugated
1-CSB-PA861184LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CPEB1. Recognizes CPEB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CPEB1 Antibody, FITC conjugated
1-CSB-PA861184LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CPEB1. Recognizes CPEB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CPEB1 Antibody, Biotin conjugated
1-CSB-PA861184LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CPEB1. Recognizes CPEB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CPEB1 Blocking Peptide
DF2462-BP	Affbiotech	1mg	EUR 195

CPEB1 cloning plasmid
CSB-CL861184HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1461 Sequence: atgcttttcccaacctctgcgcaagaatcttcccgtggcctcccagatgcaaatgacttgtgccttggcctgcagtccctcagtctgacaggctgggaccgaccctggagcacccaggactcagattcctcagcccagagcagcacacactcggtactgagcatgctccataacc Show more
Description: A cloning plasmid for the CPEB1 gene.

CPEB1 cloning plasmid
CSB-CL861184HU2-10ug	Cusabio	10ug	EUR 581
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1686 Sequence: atggcgttcccgctggaagaagaagcaggaaggataaaagattgctgggacaaccaggaagcacctgctctctccacgtgtagtaatgccaatatctttcgaaggataaatgccatattggataattctctggatttcagtagagtctgcactacacctataaaccgaggaattc Show more
Description: A cloning plasmid for the CPEB1 gene.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Polyclonal Antibody (Human)
4-PAC396Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPEB1 (Cys311~Ser561) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1)

CPEB1 protein (His tag)
80R-3792	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant CPEB1 protein (His tag)

Mouse Cpeb1 ELISA KIT
ELI-25585m	Lifescience Market	96 Tests	EUR 865

Rat CPEB1 shRNA Plasmid
20-abx988605	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CPEB1 shRNA Plasmid
20-abx969790	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CPEB1 shRNA Plasmid
20-abx962031	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CPEB1 ELISA KIT
ELI-32313h	Lifescience Market	96 Tests	EUR 824

pCMV-SPORT6-CPEB1 Plasmid
PVT16491	Lifescience Market	2 ug	EUR 325

CPEB1 Recombinant Protein (Human)
RP007852	ABM	100 ug	Ask for price

CPEB1 Recombinant Protein (Human)
RP007855	ABM	100 ug	Ask for price

CPEB1 Recombinant Protein (Rat)
RP196088	ABM	100 ug	Ask for price

CPEB1 Recombinant Protein (Mouse)
RP125720	ABM	100 ug	Ask for price

CPEB1 Recombinant Protein (Mouse)
RP125723	ABM	100 ug	Ask for price

CPEB1 Recombinant Protein (Mouse)
RP125726	ABM	100 ug	Ask for price

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Polyclonal Antibody (Human), APC
4-PAC396Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPEB1 (Cys311~Ser561) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1). This antibody is labeled with APC.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Polyclonal Antibody (Human), Biotinylated
4-PAC396Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPEB1 (Cys311~Ser561) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1). This antibody is labeled with Biotin.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Polyclonal Antibody (Human), Cy3
4-PAC396Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPEB1 (Cys311~Ser561) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1). This antibody is labeled with Cy3.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Polyclonal Antibody (Human), FITC
4-PAC396Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPEB1 (Cys311~Ser561) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1). This antibody is labeled with FITC.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Polyclonal Antibody (Human), HRP
4-PAC396Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPEB1 (Cys311~Ser561) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1). This antibody is labeled with HRP.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Polyclonal Antibody (Human), PE
4-PAC396Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPEB1 (Cys311~Ser561) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1). This antibody is labeled with PE.

Rabbit Cytoplasmic polyadenylation element binding protein 1(CPEB1) ELISA kit
E04C1998-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytoplasmic polyadenylation element binding protein 1(CPEB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytoplasmic polyadenylation element binding protein 1(CPEB1) ELISA kit
E04C1998-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytoplasmic polyadenylation element binding protein 1(CPEB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytoplasmic polyadenylation element binding protein 1(CPEB1) ELISA kit
E04C1998-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytoplasmic polyadenylation element binding protein 1(CPEB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cpeb1 ORF Vector (Rat) (pORF)
ORF065364	ABM	1.0 ug DNA	EUR 506

CPEB1 ORF Vector (Human) (pORF)
ORF002618	ABM	1.0 ug DNA	EUR 95

CPEB1 ORF Vector (Human) (pORF)
ORF002619	ABM	1.0 ug DNA	EUR 95

Cpeb1 ORF Vector (Mouse) (pORF)
ORF041908	ABM	1.0 ug DNA	EUR 506

Cpeb1 ORF Vector (Mouse) (pORF)
ORF041909	ABM	1.0 ug DNA	EUR 506

Cpeb1 ORF Vector (Mouse) (pORF)
ORF041910	ABM	1.0 ug DNA	EUR 506

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Polyclonal Antibody (Human), APC-Cy7
4-PAC396Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPEB1 (Cys311~Ser561) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1). This antibody is labeled with APC-Cy7.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Antibody
20-abx004530	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Antibody
20-abx111950	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Antibody
20-abx130866	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Antibody
abx028951-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Antibody
abx028951-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Antibody
abx432541-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Antibody
20-abx310628	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Antibody
abx231917-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Cpeb1 sgRNA CRISPR Lentivector set (Rat)
K7542701	ABM	3 x 1.0 ug	EUR 339

CPEB1 sgRNA CRISPR Lentivector set (Mouse)
K3001701	ABM	3 x 1.0 ug	EUR 339

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Antibody (HRP)
20-abx310629	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Antibody (FITC)
20-abx310630	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1) Antibody (Biotin)
20-abx310631	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cpeb1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7542702	ABM	1.0 ug DNA	EUR 154

Cpeb1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7542703	ABM	1.0 ug DNA	EUR 154

Cpeb1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7542704	ABM	1.0 ug DNA	EUR 154

CPEB1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3001702	ABM	1.0 ug DNA	EUR 154

CPEB1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3001703	ABM	1.0 ug DNA	EUR 154

CPEB1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3001704	ABM	1.0 ug DNA	EUR 154

CPEB1 Protein Vector (Mouse) (pPB-C-His)
PV167630	ABM	500 ng	EUR 1065

CPEB1 Protein Vector (Mouse) (pPB-N-His)
PV167631	ABM	500 ng	EUR 1065

CPEB1 Protein Vector (Mouse) (pPM-C-HA)
PV167632	ABM	500 ng	EUR 1065

CPEB1 Protein Vector (Mouse) (pPM-C-His)
PV167633	ABM	500 ng	EUR 1065

CPEB1 Protein Vector (Mouse) (pPB-C-His)
PV167634	ABM	500 ng	EUR 1065

CPEB1 Protein Vector (Mouse) (pPB-N-His)
PV167635	ABM	500 ng	EUR 1065

CPEB1 Protein Vector (Mouse) (pPM-C-HA)
PV167636	ABM	500 ng	EUR 1065

CPEB1 Protein Vector (Mouse) (pPM-C-His)
PV167637	ABM	500 ng	EUR 1065

CPEB1 Protein Vector (Mouse) (pPB-C-His)
PV167638	ABM	500 ng	EUR 603

CPEB1 Protein Vector (Mouse) (pPB-N-His)
PV167639	ABM	500 ng	EUR 603

CPEB1 Protein Vector (Mouse) (pPM-C-HA)
PV167640	ABM	500 ng	EUR 603

CPEB1 Protein Vector (Mouse) (pPM-C-His)
PV167641	ABM	500 ng	EUR 603

CPEB1 Protein Vector (Rat) (pPB-C-His)
PV261454	ABM	500 ng	EUR 603

CPEB1 Protein Vector (Rat) (pPB-N-His)
PV261455	ABM	500 ng	EUR 603

CPEB1 Protein Vector (Rat) (pPM-C-HA)
PV261456	ABM	500 ng	EUR 603

CPEB1 Protein Vector (Rat) (pPM-C-His)
PV261457	ABM	500 ng	EUR 603

CPEB1 Protein Vector (Human) (pPB-C-His)
PV010469	ABM	500 ng	EUR 329

CPEB1 Protein Vector (Human) (pPB-N-His)
PV010470	ABM	500 ng	EUR 329

CPEB1 Protein Vector (Human) (pPM-C-HA)
PV010471	ABM	500 ng	EUR 329

CPEB1 Protein Vector (Human) (pPM-C-His)
PV010472	ABM	500 ng	EUR 329

CPEB1 Protein Vector (Human) (pPB-C-His)
PV010473	ABM	500 ng	EUR 329

CPEB1 Protein Vector (Human) (pPB-N-His)
PV010474	ABM	500 ng	EUR 329

CPEB1 Protein Vector (Human) (pPM-C-HA)
PV010475	ABM	500 ng	EUR 329

CPEB1 Protein Vector (Human) (pPM-C-His)
PV010476	ABM	500 ng	EUR 329

Cpeb1 3'UTR GFP Stable Cell Line
TU154291	ABM	1.0 ml	Ask for price

Cpeb1 3'UTR Luciferase Stable Cell Line
TU104291	ABM	1.0 ml	Ask for price

Cpeb1 3'UTR Luciferase Stable Cell Line
TU202722	ABM	1.0 ml	Ask for price

Cpeb1 3'UTR GFP Stable Cell Line
TU252722	ABM	1.0 ml	Ask for price

CPEB1 3'UTR GFP Stable Cell Line
TU054934	ABM	1.0 ml	EUR 1394

CPEB1 3'UTR Luciferase Stable Cell Line
TU004934	ABM	1.0 ml	EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody
ABP57581-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG14L Rabbit Polyclonal Antibody
ABP57583-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

NBR1 Rabbit Polyclonal Antibody
ABP57585-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

WIPI2 Rabbit Polyclonal Antibody
ABP57587-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

WIPI2 Rabbit Polyclonal Antibody
ABP57587-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

WIPI2 Rabbit Polyclonal Antibody
ABP57587-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

FAK Rabbit Polyclonal Antibody
ABP57588-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

FAK Rabbit Polyclonal Antibody
ABP57588-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

FAK Rabbit Polyclonal Antibody
ABP57588-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

Gab1 Rabbit Polyclonal Antibody
ABP57589-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

Gab1 Rabbit Polyclonal Antibody
ABP57589-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

Gab1 Rabbit Polyclonal Antibody
ABP57589-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

ERK1 Rabbit Polyclonal Antibody
ABP57590-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

ERK1 Rabbit Polyclonal Antibody
ABP57590-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

ERK1 Rabbit Polyclonal Antibody
ABP57590-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IBA1 Polyclonal Rabbit Antibody
RA22133	Neuromics	100 ul	EUR 435

CPEB1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV708921	ABM	1.0 ug DNA	EUR 316

CPEB1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV708925	ABM	1.0 ug DNA	EUR 316

CPEB1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV708926	ABM	1.0 ug DNA	EUR 316

CPEB1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV668875	ABM	1.0 ug DNA	EUR 682

CPEB1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV668879	ABM	1.0 ug DNA	EUR 682

CPEB1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV668880	ABM	1.0 ug DNA	EUR 682

Recombinant Cytoplasmic Polyadenylation Element Binding Protein 1 (CPEB1)
4-RPC396Hu01	Cloud-Clone	EUR 386.72 EUR 206.00 EUR 1175.20 EUR 458.40 EUR 816.80 EUR 322.00 EUR 2788.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9BZB8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Cytoplasmic Polyadenylation Element Binding Protein 1 expressed in: E.coli

Recombinant Human CPEB1 Protein, His-SUMO, E.coli-100ug
QP8045-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human CPEB1 Protein, His-SUMO, E.coli-10ug
QP8045-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human CPEB1 Protein, His-SUMO, E.coli-1mg
QP8045-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human CPEB1 Protein, His-SUMO, E.coli-200ug
QP8045-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human CPEB1 Protein, His-SUMO, E.coli-500ug
QP8045-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human CPEB1 Protein, His-SUMO, E.coli-50ug
QP8045-ec-50ug	EnQuireBio	50ug	EUR 263

Rabbit polyclonal antibody for Shigella
704	Virostat	1 ml	EUR 321.88
Description: This is HRP conjugated rabbit polyclonal antibody against Shigella group for WB, ELISA.

5-hmC polyclonal antibody (rabbit)
6830-50	Biovision		EUR 316

Cyclooxygenase 1 Rabbit Polyclonal Antibody
38023-100ul	SAB	100ul	EUR 252

Cyclooxygenase 1 Rabbit Polyclonal Antibody
38023-50ul	SAB	50ul	EUR 187

Cyclooxygenase 2 Rabbit Polyclonal Antibody
38024-100ul	SAB	100ul	EUR 252

Cyclooxygenase 2 Rabbit Polyclonal Antibody
38024-50ul	SAB	50ul	EUR 187

Histone H3 Rabbit Polyclonal Antibody
38103-100ul	SAB	100ul	EUR 252

Histone H3 Rabbit Polyclonal Antibody
38103-50ul	SAB	50ul	EUR 187

Rabbit polyclonal METTL8(1) antibody
40013-100ul	SAB	100ul	EUR 390

Rabbit Anti-Clostridium Polyclonal Antibody
DPAB0230	Creative Diagnostics	1 ml	EUR 689

Rabbit Anti-Aspergillus Polyclonal Antibody
DPAB0232	Creative Diagnostics	1 ml	EUR 781

Rabbit Anti Aldosterone Polyclonal Antibody
DPBT-65724RA	Creative Diagnostics	1 ml	EUR 580

Rabbit Anti Cortisol Polyclonal Antibody
DPBT-65739RC	Creative Diagnostics	0.25 ml	EUR 663

Rabbit Anti Progesterone Polyclonal Antibody
DPBT-65781RP	Creative Diagnostics	0.2 ml	EUR 767

Rabbit Anti Progesterone Polyclonal Antibody
DPBT-65782RP	Creative Diagnostics	1 ml	EUR 580

Rabbit Anti Laminin Polyclonal Antibody
DPBT-66636RL	Creative Diagnostics	50 µl	EUR 429

Rabbit Anti Acetylcholine Polyclonal Antibody
DPBT-66692RA	Creative Diagnostics	1 ml	EUR 861

Rabbit Anti Serotonin Polyclonal Antibody
DPBT-66744RS	Creative Diagnostics	0.1 ml	EUR 1287

Rabbit Anti Serotonin Polyclonal Antibody
DPBT-66745RS	Creative Diagnostics	50 µl	EUR 580

Rabbit Anti Aspergillus Polyclonal Antibody
DPBT-66808RA	Creative Diagnostics	1 ml	EUR 767

Rabbit Anti Tubulin Polyclonal Antibody
DPBT-67229RT	Creative Diagnostics	0.5 ml	EUR 663

Rabbit Anti Morf4 Polyclonal Antibody
DPBT-67360RM	Creative Diagnostics	50 µg	EUR 533

Rabbit Anti Morf4 Polyclonal Antibody
DPBT-67361RM	Creative Diagnostics	0.1 mg	EUR 663

Rabbit Anti Fitc Polyclonal Antibody
DPBT-68178RF	Creative Diagnostics	1 mg	EUR 944

Rabbit Anti Hexokinase Polyclonal Antibody
DPBT-68187RH	Creative Diagnostics	1 ml	EUR 819

Rabbit Anti Fitc Polyclonal Antibody
DPBT-68210RF	Creative Diagnostics	1 ml	EUR 580

Rabbit Anti Phosphoserine Polyclonal Antibody
DPBT-68211RP	Creative Diagnostics	50 µg	EUR 1089

Rabbit Anti Phosphoserine Polyclonal Antibody
DPBT-68214RP	Creative Diagnostics	50 µg	EUR 892

Rabbit Anti Phosphothreonine Polyclonal Antibody
DPBT-68217RP	Creative Diagnostics	50 µg	EUR 710

Rabbit Anti Phenobarbital Polyclonal Antibody
DPBT-68286RP	Creative Diagnostics	1 ml	EUR 663

Rabbit Anti Theophylline Polyclonal Antibody
DPBT-68291RT	Creative Diagnostics	1 ml	EUR 663

Rabbit Anti Vancomycin Polyclonal Antibody
DPBT-68294RV	Creative Diagnostics	1 ml	EUR 580

Polyclonal Rabbit Anti-AXL antibody
APR05486G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rabbit Anti-AXL . This antibody is tested and proven to work in the following applications:

Polyclonal Rabbit Anti-DHCR7 antibody
AMR09690G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rabbit Anti-DHCR7 . This antibody is tested and proven to work in the following applications:

Polyclonal Rabbit Anti-IFNGR2 antibody
AMR09691G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rabbit Anti-IFNGR2 . This antibody is tested and proven to work in the following applications:

Polyclonal Rabbit Anti-STRA6 antibody
AMR09692G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rabbit Anti-STRA6 . This antibody is tested and proven to work in the following applications:

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Rabbit Anti-C1q Polyclonal Antibody
CTA-356-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-C1q polyclonal antibodyfor WB.

Rabbit Anti-C1q Polyclonal Antibody
CTA-356-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-C1q polyclonal antibodyfor WB.

Rabbit Anti-C1QL1 Polyclonal Antibody
CTA-368-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit mouse anti-C1QL1 polyclonal antibodyfor WB.

Rabbit Anti-C1QL1 Polyclonal Antibody
CTA-368-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit mouse anti-C1QL1 polyclonal antibodyfor WB.

Rabbit Anti-C1QB Polyclonal Antibody
CTA-389-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-C1QB polyclonal antibodyfor WB.

Rabbit Anti-C1QB Polyclonal Antibody
CTA-389-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-C1QB polyclonal antibodyfor WB.

Rabbit Anti-Properdin Polyclonal Antibody
CTA-394-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-Properdin polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-Properdin Polyclonal Antibody
CTA-394-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-Properdin polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-C8B Polyclonal Antibody
CTA-425-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-C8B polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-C8B Polyclonal Antibody
CTA-425-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-C8B polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-C8G Polyclonal Antibody
CTA-426-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-C8G polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-C8G Polyclonal Antibody
CTA-426-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-C8G polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-Vitronectin Polyclonal Antibody
CTA-430-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-Vitronectin polyclonal antibodyfor ICC/IF, IHC, IHC-P.

Rabbit Anti-Vitronectin Polyclonal Antibody
CTA-430-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-Vitronectin polyclonal antibodyfor ICC/IF, IHC, IHC-P.

Rabbit Anti-CTRP2 Polyclonal Antibody
CTA-437-100ug	Creative Biolabs	100ug	Ask for price
Description: Mouse anti-CTRP2 polyclonal antibody for ICC/IF, IHC, IHC-P.

Rabbit Anti-CTRP2 Polyclonal Antibody
CTA-437-1mg	Creative Biolabs	1mg	Ask for price
Description: Mouse anti-CTRP2 polyclonal antibody for ICC/IF, IHC, IHC-P.

Rabbit Anti-CTRP6 Polyclonal Antibody
CTA-442-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-CTRP6 polyclonal antibody for WB, ELISA, ICC/IF, IHC, IHC-P.

Rabbit Anti-CTRP6 Polyclonal Antibody
CTA-442-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-CTRP6 polyclonal antibody for WB, ELISA, ICC/IF, IHC, IHC-P.

Rabbit Anti-CTRP7 Polyclonal Antibody
CTA-449-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-CTRP7 polyclonal antibody for WB, ELISA, ICC/IF, IHC, IHC-P.

Rabbit Anti-CTRP7 Polyclonal Antibody
CTA-449-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-CTRP7 polyclonal antibody for WB, ELISA, ICC/IF, IHC, IHC-P.

Rabbit Anti-CD11c Polyclonal Antibody
CTA-474-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-CD11c polyclonal antibodyfor IHC-P.

Rabbit Anti-CD11c Polyclonal Antibody
CTA-474-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-CD11c polyclonal antibodyfor IHC-P.

Rabbit Anti-CD21 Polyclonal Antibody
CTA-477-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-CD21 polyclonal antibodyfor IHC, IHC-P.

Rabbit Anti-CD21 Polyclonal Antibody
CTA-477-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-CD21 polyclonal antibodyfor IHC, IHC-P.

Rabbit Anti-CD35 Polyclonal Antibody
CTA-480-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-CD35 polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-CD35 Polyclonal Antibody
CTA-480-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-CD35 polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-SHMT2 Polyclonal Antibody
CTA-491-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-SHMT2 polyclonal antibodyfor WB, ICC/IF, IHC, IHC-P.

Rabbit Anti-SHMT2 Polyclonal Antibody
CTA-491-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-SHMT2 polyclonal antibodyfor WB, ICC/IF, IHC, IHC-P.

Rabbit Anti-RGC32 Polyclonal Antibody
CTA-494-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-RGC32 polyclonal antibodyfor ICC/IF.

Rabbit Anti-RGC32 Polyclonal Antibody
CTA-494-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-RGC32 polyclonal antibodyfor ICC/IF.

Rabbit Anti-DHODH Polyclonal Antibody
CTA-501-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-DHODH polyclonal antibodyfor WB.

Rabbit Anti-DHODH Polyclonal Antibody
CTA-501-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-DHODH polyclonal antibodyfor WB.

Rabbit Anti-CD46 Polyclonal Antibody
CTA-513-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-CD46 polyclonal antibodyfor IHC, IHC-P.

Rabbit Anti-CD46 Polyclonal Antibody
CTA-513-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-CD46 polyclonal antibodyfor IHC, IHC-P.

Rabbit Anti-CD59 Polyclonal Antibody
CTA-521-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-CD59 polyclonal antibodyfor ELISA.

Rabbit Anti-CD59 Polyclonal Antibody
CTA-521-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-CD59 polyclonal antibodyfor ELISA.

beta Actin Rabbit Polyclonal Antibody
A01011-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:3000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of beta Actin from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This beta Actin antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

beta Actin Rabbit Polyclonal Antibody
A01011-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:3000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of beta Actin from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This beta Actin antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

beta Actin Rabbit Polyclonal Antibody
A01011-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:3000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of beta Actin from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This beta Actin antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

DDDDK Tag Rabbit Polyclonal Antibody
A02011-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DDDDK Tag from Null. This DDDDK Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DDDDK Tag Rabbit Polyclonal Antibody
A02011-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DDDDK Tag from Null. This DDDDK Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DDDDK Tag Rabbit Polyclonal Antibody
A02011-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DDDDK Tag from Null. This DDDDK Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DDDDK Tag Rabbit Polyclonal Antibody
A02011HRP-005ml	Abbkine	0.05ml	EUR 180
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DDDDK Tag from Null. This DDDDK Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DDDDK Tag Rabbit Polyclonal Antibody
A02011HRP-02ml	Abbkine	0.2ml	EUR 398
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DDDDK Tag from Null. This DDDDK Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DDDDK Tag Rabbit Polyclonal Antibody
A02011HRP-02ml5	Abbkine	0.2ml×5	EUR 1265
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DDDDK Tag from Null. This DDDDK Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in rabbit by using as an immunogen synthetic peptide

GFP Tag Rabbit Polyclonal Antibody
A02021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of GFP Tag from Null. This GFP Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

<