CYB5B Rabbit Polyclonal Antibody
CYB5B Polyclonal Antibody |
ABP58310-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CYB5B protein at amino acid sequence of 50-130
- Applications tips:
|
Description: A polyclonal antibody for detection of CYB5B from Human. This CYB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CYB5B protein at amino acid sequence of 50-130 |
CYB5B Polyclonal Antibody |
A62362 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
CYB5B Rabbit pAb |
A15900-100ul |
Abclonal |
100 ul |
EUR 308 |
CYB5B Rabbit pAb |
A15900-200ul |
Abclonal |
200 ul |
EUR 459 |
CYB5B Rabbit pAb |
A15900-20ul |
Abclonal |
20 ul |
EUR 183 |
CYB5B Rabbit pAb |
A15900-50ul |
Abclonal |
50 ul |
EUR 223 |
CYB5B Antibody |
44797-100ul |
SAB |
100ul |
EUR 252 |
CYB5B Antibody |
44797-50ul |
SAB |
50ul |
EUR 187 |
CYB5B antibody |
70R-16692 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CYB5B antibody |
CYB5B Antibody |
DF2488 |
Affbiotech |
200ul |
EUR 304 |
Description: CYB5B antibody detects endogenous levels of total CYB5B. |
CYB5B Antibody |
1-CSB-PA006310GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CYB5B Antibody |
1-CSB-PA006310LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200 |
CYB5B Polyclonal Antibody, HRP Conjugated |
A62363 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
CYB5B Polyclonal Antibody, FITC Conjugated |
A62364 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
CYB5B Polyclonal Antibody, Biotin Conjugated |
A62365 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
CYB5B Conjugated Antibody |
C44797 |
SAB |
100ul |
EUR 397 |
anti- CYB5B antibody |
FNab02114 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: cytochrome b5 type B(outer mitochondrial membrane)
- Uniprot ID: O43169
- Gene ID: 80777
- Research Area: Metabolism
|
Description: Antibody raised against CYB5B |
Anti-CYB5B antibody |
STJ191838 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CYB5B |
CYB5B siRNA |
20-abx901362 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CYB5B siRNA |
20-abx913300 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CYB5B siRNA |
20-abx913301 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CYB5B Antibody, HRP conjugated |
1-CSB-PA006310LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CYB5B Antibody, FITC conjugated |
1-CSB-PA006310LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CYB5B Antibody, Biotin conjugated |
1-CSB-PA006310LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CYB5B cloning plasmid |
CSB-CL006310HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 441
- Sequence: atggcgactgcggaagctagcggcagcgatgggaaagggcaggaagtcgagacctcagtcacctattaccggttggaggaggtggcaaagcgcaactccttgaaggaactgtggcttgtgatccatgggcgagtctacgatgtcacccgcttcctcaacgagcaccctggaggaga
- Show more
|
Description: A cloning plasmid for the CYB5B gene. |
CYB5B Blocking Peptide |
DF2488-BP |
Affbiotech |
1mg |
EUR 195 |
Rabbit Cytochrome b5 type B(CYB5B) ELISA kit |
E04C2207-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome b5 type B(CYB5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cytochrome b5 type B(CYB5B) ELISA kit |
E04C2207-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome b5 type B(CYB5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cytochrome b5 type B(CYB5B) ELISA kit |
E04C2207-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome b5 type B(CYB5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Cytochrome B5 Type B (CYB5B) Antibody |
20-abx111900 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cytochrome B5 Type B (CYB5B) Antibody |
20-abx219509 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cytochrome B5 Type B (CYB5B) Antibody |
20-abx318446 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cytochrome B5 Type B (CYB5B) Antibody |
abx232114-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Mouse CYB5B shRNA Plasmid |
20-abx975605 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat CYB5B shRNA Plasmid |
20-abx986566 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CYB5B shRNA Plasmid |
20-abx962912 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CYB5B Recombinant Protein (Human) |
RP008536 |
ABM |
100 ug |
Ask for price |
CYB5B Recombinant Protein (Rat) |
RP196961 |
ABM |
100 ug |
Ask for price |
CYB5B Recombinant Protein (Mouse) |
RP126953 |
ABM |
100 ug |
Ask for price |
Cytochrome B5 Type B (CYB5B) Antibody (HRP) |
20-abx303555 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cytochrome B5 Type B (CYB5B) Antibody (FITC) |
20-abx303556 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cytochrome B5 Type B (CYB5B) Antibody (Biotin) |
20-abx303557 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CYB5B ORF Vector (Human) (pORF) |
ORF002846 |
ABM |
1.0 ug DNA |
EUR 95 |
Cyb5b ORF Vector (Rat) (pORF) |
ORF065655 |
ABM |
1.0 ug DNA |
EUR 506 |
Cyb5b ORF Vector (Mouse) (pORF) |
ORF042319 |
ABM |
1.0 ug DNA |
EUR 506 |
CYB5B sgRNA CRISPR Lentivector set (Human) |
K0541301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cyb5b sgRNA CRISPR Lentivector set (Rat) |
K7537501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cyb5b sgRNA CRISPR Lentivector set (Mouse) |
K4948501 |
ABM |
3 x 1.0 ug |
EUR 339 |
CYB5B sgRNA CRISPR Lentivector (Human) (Target 1) |
K0541302 |
ABM |
1.0 ug DNA |
EUR 154 |
CYB5B sgRNA CRISPR Lentivector (Human) (Target 2) |
K0541303 |
ABM |
1.0 ug DNA |
EUR 154 |
CYB5B sgRNA CRISPR Lentivector (Human) (Target 3) |
K0541304 |
ABM |
1.0 ug DNA |
EUR 154 |
Cyb5b sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7537502 |
ABM |
1.0 ug DNA |
EUR 154 |
Cyb5b sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7537503 |
ABM |
1.0 ug DNA |
EUR 154 |
Cyb5b sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7537504 |
ABM |
1.0 ug DNA |
EUR 154 |
Cyb5b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4948502 |
ABM |
1.0 ug DNA |
EUR 154 |
Cyb5b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4948503 |
ABM |
1.0 ug DNA |
EUR 154 |
Cyb5b sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4948504 |
ABM |
1.0 ug DNA |
EUR 154 |
CYB5B Protein Vector (Human) (pPB-C-His) |
PV011381 |
ABM |
500 ng |
EUR 329 |
CYB5B Protein Vector (Human) (pPB-N-His) |
PV011382 |
ABM |
500 ng |
EUR 329 |
CYB5B Protein Vector (Human) (pPM-C-HA) |
PV011383 |
ABM |
500 ng |
EUR 329 |
CYB5B Protein Vector (Human) (pPM-C-His) |
PV011384 |
ABM |
500 ng |
EUR 329 |
CYB5B Protein Vector (Mouse) (pPB-C-His) |
PV169274 |
ABM |
500 ng |
EUR 603 |
CYB5B Rabbit Polyclonal Antibody