CYB5B Rabbit Polyclonal Antibody

CYB5B Rabbit Polyclonal Antibody

CYB5B Polyclonal Antibody

ABP58310-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CYB5B protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of CYB5B from Human. This CYB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CYB5B protein at amino acid sequence of 50-130

CYB5B Polyclonal Antibody

A62362 100 µg
EUR 570.55
Description: The best epigenetics products

CYB5B Rabbit pAb

A15900-100ul 100 ul
EUR 308

CYB5B Rabbit pAb

A15900-200ul 200 ul
EUR 459

CYB5B Rabbit pAb

A15900-20ul 20 ul
EUR 183

CYB5B Rabbit pAb

A15900-50ul 50 ul
EUR 223

CYB5B Antibody

ABD2488 100 ug
EUR 438

CYB5B Antibody

44797-100ul 100ul
EUR 252

CYB5B Antibody

44797-50ul 50ul
EUR 187

CYB5B antibody

70R-16692 50 ul
EUR 435
Description: Rabbit polyclonal CYB5B antibody

CYB5B Antibody

DF2488 200ul
EUR 304
Description: CYB5B antibody detects endogenous levels of total CYB5B.

CYB5B Antibody

1-CSB-PA006310GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CYB5B Antibody

1-CSB-PA006310LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

CYB5B Polyclonal Antibody, HRP Conjugated

A62363 100 µg
EUR 570.55
Description: kits suitable for this type of research

CYB5B Polyclonal Antibody, FITC Conjugated

A62364 100 µg
EUR 570.55
Description: fast delivery possible

CYB5B Polyclonal Antibody, Biotin Conjugated

A62365 100 µg
EUR 570.55
Description: reagents widely cited

CYB5B Conjugated Antibody

C44797 100ul
EUR 397

anti- CYB5B antibody

FNab02114 100µg
EUR 505.25
  • Immunogen: cytochrome b5 type B(outer mitochondrial membrane)
  • Uniprot ID: O43169
  • Gene ID: 80777
  • Research Area: Metabolism
Description: Antibody raised against CYB5B

Anti-CYB5B antibody

PAab02114 100 ug
EUR 355

Anti-CYB5B antibody

STJ118359 100 µl
EUR 277

Anti-CYB5B antibody

STJ191838 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CYB5B

Cyb5b/ Rat Cyb5b ELISA Kit

ELI-32376r 96 Tests
EUR 886

CYB5B siRNA

20-abx901362
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CYB5B siRNA

20-abx913300
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CYB5B siRNA

20-abx913301
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CYB5B Antibody, HRP conjugated

1-CSB-PA006310LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CYB5B Antibody, FITC conjugated

1-CSB-PA006310LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CYB5B Antibody, Biotin conjugated

1-CSB-PA006310LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CYB5B cloning plasmid

CSB-CL006310HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 441
  • Sequence: atggcgactgcggaagctagcggcagcgatgggaaagggcaggaagtcgagacctcagtcacctattaccggttggaggaggtggcaaagcgcaactccttgaaggaactgtggcttgtgatccatgggcgagtctacgatgtcacccgcttcctcaacgagcaccctggaggaga
  • Show more
Description: A cloning plasmid for the CYB5B gene.

CYB5B Blocking Peptide

DF2488-BP 1mg
EUR 195

Rabbit Cytochrome b5 type B(CYB5B) ELISA kit

E04C2207-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome b5 type B(CYB5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytochrome b5 type B(CYB5B) ELISA kit

E04C2207-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome b5 type B(CYB5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytochrome b5 type B(CYB5B) ELISA kit

E04C2207-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome b5 type B(CYB5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cytochrome B5 Type B (CYB5B) Antibody

20-abx111900
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cytochrome B5 Type B (CYB5B) Antibody

20-abx219509
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cytochrome B5 Type B (CYB5B) Antibody

20-abx318446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cytochrome B5 Type B (CYB5B) Antibody

abx232114-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Mouse CYB5B shRNA Plasmid

20-abx975605
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CYB5B shRNA Plasmid

20-abx986566
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CYB5B shRNA Plasmid

20-abx962912
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CYB5B ELISA KIT|Human

EF008937 96 Tests
EUR 689

CYB5B Recombinant Protein (Human)

RP008536 100 ug Ask for price

CYB5B Recombinant Protein (Rat)

RP196961 100 ug Ask for price

CYB5B Recombinant Protein (Mouse)

RP126953 100 ug Ask for price

Cytochrome B5 Type B (CYB5B) Antibody (HRP)

20-abx303555
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cytochrome B5 Type B (CYB5B) Antibody (FITC)

20-abx303556
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cytochrome B5 Type B (CYB5B) Antibody (Biotin)

20-abx303557
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CYB5B ORF Vector (Human) (pORF)

ORF002846 1.0 ug DNA
EUR 95

Cyb5b ORF Vector (Rat) (pORF)

ORF065655 1.0 ug DNA
EUR 506

Cyb5b ORF Vector (Mouse) (pORF)

ORF042319 1.0 ug DNA
EUR 506

CYB5B sgRNA CRISPR Lentivector set (Human)

K0541301 3 x 1.0 ug
EUR 339

Cyb5b sgRNA CRISPR Lentivector set (Rat)

K7537501 3 x 1.0 ug
EUR 339

Cyb5b sgRNA CRISPR Lentivector set (Mouse)

K4948501 3 x 1.0 ug
EUR 339

CYB5B sgRNA CRISPR Lentivector (Human) (Target 1)

K0541302 1.0 ug DNA
EUR 154

CYB5B sgRNA CRISPR Lentivector (Human) (Target 2)

K0541303 1.0 ug DNA
EUR 154

CYB5B sgRNA CRISPR Lentivector (Human) (Target 3)

K0541304 1.0 ug DNA
EUR 154

Cyb5b sgRNA CRISPR Lentivector (Rat) (Target 1)

K7537502 1.0 ug DNA
EUR 154

Cyb5b sgRNA CRISPR Lentivector (Rat) (Target 2)

K7537503 1.0 ug DNA
EUR 154

Cyb5b sgRNA CRISPR Lentivector (Rat) (Target 3)

K7537504 1.0 ug DNA
EUR 154

Cyb5b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4948502 1.0 ug DNA
EUR 154

Cyb5b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4948503 1.0 ug DNA
EUR 154

Cyb5b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4948504 1.0 ug DNA
EUR 154

CYB5B Protein Vector (Human) (pPB-C-His)

PV011381 500 ng
EUR 329

CYB5B Protein Vector (Human) (pPB-N-His)

PV011382 500 ng
EUR 329

CYB5B Protein Vector (Human) (pPM-C-HA)

PV011383 500 ng
EUR 329

CYB5B Protein Vector (Human) (pPM-C-His)

PV011384 500 ng
EUR 329

CYB5B Protein Vector (Mouse) (pPB-C-His)

PV169274 500 ng
EUR 603

CYB5B Rabbit Polyclonal Antibody