DEDD Rabbit Polyclonal Antibody

DEDD Rabbit Polyclonal Antibody

DEDD Polyclonal Antibody

ES10681-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DEDD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

DEDD Polyclonal Antibody

ES10681-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DEDD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

DEDD Rabbit pAb

A5806-100ul 100 ul
EUR 308

DEDD Rabbit pAb

A5806-200ul 200 ul
EUR 459

DEDD Rabbit pAb

A5806-20ul 20 ul
EUR 183

DEDD Rabbit pAb

A5806-50ul 50 ul
EUR 223

DEDD Polyclonal Conjugated Antibody

C30666 100ul
EUR 397

DEDD antibody

22334-100ul 100ul
EUR 390

DEDD antibody

70R-16797 50 ul
EUR 435
Description: Rabbit polyclonal DEDD antibody

DEDD antibody

70R-13451 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal DEDD antibody

DEDD Antibody

DF10100 200ul
EUR 304
Description: DEDD Antibody detects endogenous levels of total DEDD.

DEDD Antibody

1-CSB-PA006648ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DEDD. Recognizes DEDD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

DEDD Antibody

1-CSB-PA006648ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DEDD. Recognizes DEDD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DEDD Antibody

1-CSB-PA006648GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DEDD. Recognizes DEDD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

DEDD Antibody

ABD10100 100 ug
EUR 438

Dedd/ Rat Dedd ELISA Kit

ELI-32183r 96 Tests
EUR 886

anti- DEDD antibody

FNab02323 100µg
EUR 585
  • Immunogen: death effector domain containing
  • Uniprot ID: O75618
  • Gene ID: 9191
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against DEDD

Anti-DEDD antibody

PAab02323 100 ug
EUR 412

Anti-DEDD antibody

STJ28369 100 µl
EUR 277
Description: This gene encodes a protein that contains a death effector domain (DED). DED is a protein-protein interaction domain shared by adaptors, regulators and executors of the programmed cell death pathway. Overexpression of this gene was shown to induce weak apoptosis. Upon stimulation, this protein was found to translocate from cytoplasm to nucleus and colocalize with UBTF, a basal factor required for RNA polymerase I transcription, in the nucleolus. At least three transcript variants encoding the same protein have been found for this gene.

Anti-DEDD antibody

STJ191839 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DEDD

DEDD siRNA

20-abx901465
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DEDD siRNA

20-abx913849
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DEDD siRNA

20-abx913850
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DEDD

YF-PA25284 50 ul
EUR 334
Description: Mouse polyclonal to DEDD

DEDD Blocking Peptide

DF10100-BP 1mg
EUR 195

DEDD cloning plasmid

CSB-CL006648HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 957
  • Sequence: atggcgggcctaaagcggcgggcaagccaggtgtggccagaagagcatggtgagcaggaacatgggctgtacagcctgcaccgcatgtttgacatcgtgggcactcatctgacacacagagatgtgcgcgtgctttctttcctctttgttgatgtcattgatgaccacgagcgtgg
  • Show more
Description: A cloning plasmid for the DEDD gene.

Anti-DEDD (1C7)

YF-MA16708 100 ug
EUR 363
Description: Mouse monoclonal to DEDD

DEDD protein (His tag)

80R-2649 50 ug
EUR 424
Description: Purified recombinant Human DEDD protein (His tag)

DEDD ELISA KIT|Human

EF009070 96 Tests
EUR 689

Mouse DEDD shRNA Plasmid

20-abx973166
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat DEDD shRNA Plasmid

20-abx986826
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DEDD shRNA Plasmid

20-abx956083
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DEDD Recombinant Protein (Human)

RP009070 100 ug Ask for price

DEDD Recombinant Protein (Rat)

RP197711 100 ug Ask for price

DEDD Recombinant Protein (Mouse)

RP128495 100 ug Ask for price

DEDD Recombinant Protein (Mouse)

RP128498 100 ug Ask for price

Death Effector Domain Containing (DEDD) Antibody

20-abx004448
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Death Effector Domain Containing (DEDD) Antibody

20-abx112000
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Death Effector Domain Containing (DEDD) Antibody

abx122544-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Death Effector Domain Containing (DEDD) Antibody

abx149765-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Death Effector Domain Containing (DEDD) Antibody

20-abx320685
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Death Effector Domain Containing (DEDD) Antibody

20-abx322366
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Death Effector Domain Containing (DEDD) Antibody

abx232323-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Monoclonal DEDD Antibody (monoclonal) (M01), Clone: 1C7

AMM03455G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human DEDD (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1C7. This antibody is applicable in WB

Dedd ORF Vector (Rat) (pORF)

ORF065905 1.0 ug DNA
EUR 506

DEDD ORF Vector (Human) (pORF)

ORF003024 1.0 ug DNA
EUR 95

Dedd ORF Vector (Mouse) (pORF)

ORF042833 1.0 ug DNA
EUR 506

Dedd ORF Vector (Mouse) (pORF)

ORF042834 1.0 ug DNA
EUR 506

DEDD sgRNA CRISPR Lentivector set (Human)

K0576201 3 x 1.0 ug
EUR 339

Dedd sgRNA CRISPR Lentivector set (Rat)

K6980801 3 x 1.0 ug
EUR 339

Dedd sgRNA CRISPR Lentivector set (Mouse)

K3720601 3 x 1.0 ug
EUR 339

Human Death effector domain-containing protein (DEDD)

1-CSB-EP006648HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 63.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Death effector domain-containing protein(DEDD) expressed in E.coli

DEDD sgRNA CRISPR Lentivector (Human) (Target 1)

K0576202 1.0 ug DNA
EUR 154

DEDD sgRNA CRISPR Lentivector (Human) (Target 2)

K0576203 1.0 ug DNA
EUR 154

DEDD sgRNA CRISPR Lentivector (Human) (Target 3)

K0576204 1.0 ug DNA
EUR 154

Dedd sgRNA CRISPR Lentivector (Rat) (Target 1)

K6980802 1.0 ug DNA
EUR 154

Dedd sgRNA CRISPR Lentivector (Rat) (Target 2)

K6980803 1.0 ug DNA
EUR 154

Dedd sgRNA CRISPR Lentivector (Rat) (Target 3)

K6980804 1.0 ug DNA
EUR 154

Dedd sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3720602 1.0 ug DNA
EUR 154

Dedd sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3720603 1.0 ug DNA
EUR 154

Dedd sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3720604 1.0 ug DNA
EUR 154

DEDD Protein Vector (Mouse) (pPB-C-His)

PV171330 500 ng
EUR 603

DEDD Protein Vector (Mouse) (pPB-N-His)

PV171331 500 ng
EUR 603

DEDD Protein Vector (Mouse) (pPM-C-HA)

PV171332 500 ng
EUR 603

DEDD Protein Vector (Mouse) (pPM-C-His)

PV171333 500 ng
EUR 603

DEDD Protein Vector (Mouse) (pPB-C-His)

PV171334 500 ng
EUR 603

DEDD Protein Vector (Mouse) (pPB-N-His)

PV171335 500 ng
EUR 603

DEDD Protein Vector (Mouse) (pPM-C-HA)

PV171336 500 ng
EUR 603

DEDD Rabbit Polyclonal Antibody