DEDD Rabbit Polyclonal Antibody

DEDD Rabbit Polyclonal Antibody

DEDD Polyclonal Antibody
30666-100ul	SAB	100ul	EUR 252

DEDD Polyclonal Antibody
30666-50ul	SAB	50ul	EUR 187

DEDD Rabbit pAb
A5806-100ul	Abclonal	100 ul	EUR 308

DEDD Rabbit pAb
A5806-200ul	Abclonal	200 ul	EUR 459

DEDD Rabbit pAb
A5806-20ul	Abclonal	20 ul	EUR 183

DEDD Rabbit pAb
A5806-50ul	Abclonal	50 ul	EUR 223

DEDD Polyclonal Conjugated Antibody
C30666	SAB	100ul	EUR 397

DEDD Antibody
ABD10100	Lifescience Market	100 ug	EUR 438

DEDD antibody
22334-100ul	SAB	100ul	EUR 390

DEDD antibody
70R-13451	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal DEDD antibody

DEDD antibody
70R-16797	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DEDD antibody

DEDD Antibody
DF10100	Affbiotech	200ul	EUR 304
Description: DEDD Antibody detects endogenous levels of total DEDD.

DEDD Antibody
1-CSB-PA006648ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DEDD. Recognizes DEDD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

DEDD Antibody
1-CSB-PA006648ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DEDD. Recognizes DEDD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DEDD Antibody
1-CSB-PA006648GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DEDD. Recognizes DEDD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Dedd/ Rat Dedd ELISA Kit
ELI-32183r	Lifescience Market	96 Tests	EUR 886

anti- DEDD antibody
FNab02323	FN Test	100µg	EUR 585
Immunogen: death effector domain containing Uniprot ID: O75618 Gene ID: 9191 Research Area: Metabolism, Developmental biology
Description: Antibody raised against DEDD

Anti-DEDD antibody
PAab02323	Lifescience Market	100 ug	EUR 412

Anti-DEDD antibody
STJ28369	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that contains a death effector domain (DED). DED is a protein-protein interaction domain shared by adaptors, regulators and executors of the programmed cell death pathway. Overexpression of this gene was shown to induce weak apoptosis. Upon stimulation, this protein was found to translocate from cytoplasm to nucleus and colocalize with UBTF, a basal factor required for RNA polymerase I transcription, in the nucleolus. At least three transcript variants encoding the same protein have been found for this gene.

Anti-DEDD antibody
STJ191839	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DEDD

DEDD siRNA
20-abx901465	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DEDD siRNA
20-abx913849	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DEDD siRNA
20-abx913850	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-DEDD
YF-PA25284	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to DEDD

DEDD cloning plasmid
CSB-CL006648HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 957 Sequence: atggcgggcctaaagcggcgggcaagccaggtgtggccagaagagcatggtgagcaggaacatgggctgtacagcctgcaccgcatgtttgacatcgtgggcactcatctgacacacagagatgtgcgcgtgctttctttcctctttgttgatgtcattgatgaccacgagcgtgg Show more
Description: A cloning plasmid for the DEDD gene.

DEDD Blocking Peptide
DF10100-BP	Affbiotech	1mg	EUR 195

Anti-DEDD (1C7)
YF-MA16708	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DEDD

Rat DEDD shRNA Plasmid
20-abx986826	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DEDD ELISA KIT|Human
EF009070	Lifescience Market	96 Tests	EUR 689

Human DEDD shRNA Plasmid
20-abx956083	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DEDD protein (His tag)
80R-2649	Fitzgerald	50 ug	EUR 424
Description: Purified recombinant Human DEDD protein (His tag)

Mouse DEDD shRNA Plasmid
20-abx973166	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DEDD Recombinant Protein (Human)
RP009070	ABM	100 ug	Ask for price

DEDD Recombinant Protein (Rat)
RP197711	ABM	100 ug	Ask for price

DEDD Recombinant Protein (Mouse)
RP128495	ABM	100 ug	Ask for price

DEDD Recombinant Protein (Mouse)
RP128498	ABM	100 ug	Ask for price

Death Effector Domain Containing (DEDD) Antibody
20-abx112000	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Death Effector Domain Containing (DEDD) Antibody
abx122544-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Death Effector Domain Containing (DEDD) Antibody
abx149765-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Death Effector Domain Containing (DEDD) Antibody
20-abx004448	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Death Effector Domain Containing (DEDD) Antibody
20-abx320685	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Death Effector Domain Containing (DEDD) Antibody
20-abx322366	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Death Effector Domain Containing (DEDD) Antibody
abx232323-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Monoclonal DEDD Antibody (monoclonal) (M01), Clone: 1C7
AMM03455G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human DEDD (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1C7. This antibody is applicable in WB

DEDD ORF Vector (Human) (pORF)
ORF003024	ABM	1.0 ug DNA	EUR 95

Dedd ORF Vector (Rat) (pORF)
ORF065905	ABM	1.0 ug DNA	EUR 506

Dedd ORF Vector (Mouse) (pORF)
ORF042833	ABM	1.0 ug DNA	EUR 506

Dedd ORF Vector (Mouse) (pORF)
ORF042834	ABM	1.0 ug DNA	EUR 506

DEDD sgRNA CRISPR Lentivector set (Human)
K0576201	ABM	3 x 1.0 ug	EUR 339

Dedd sgRNA CRISPR Lentivector set (Mouse)
K3720601	ABM	3 x 1.0 ug	EUR 339

Dedd sgRNA CRISPR Lentivector set (Rat)
K6980801	ABM	3 x 1.0 ug	EUR 339

DEDD sgRNA CRISPR Lentivector (Human) (Target 1)
K0576202	ABM	1.0 ug DNA	EUR 154

DEDD sgRNA CRISPR Lentivector (Human) (Target 2)
K0576203	ABM	1.0 ug DNA	EUR 154

DEDD sgRNA CRISPR Lentivector (Human) (Target 3)
K0576204	ABM	1.0 ug DNA	EUR 154

Dedd sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3720602	ABM	1.0 ug DNA	EUR 154

Dedd sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3720603	ABM	1.0 ug DNA	EUR 154

Dedd sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3720604	ABM	1.0 ug DNA	EUR 154

Human Death effector domain-containing protein (DEDD)
1-CSB-EP006648HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 63.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Death effector domain-containing protein(DEDD) expressed in E.coli

Dedd sgRNA CRISPR Lentivector (Rat) (Target 1)
K6980802	ABM	1.0 ug DNA	EUR 154

Dedd sgRNA CRISPR Lentivector (Rat) (Target 2)
K6980803	ABM	1.0 ug DNA	EUR 154

Dedd sgRNA CRISPR Lentivector (Rat) (Target 3)
K6980804	ABM	1.0 ug DNA	EUR 154

DEDD Protein Vector (Human) (pPB-C-His)
PV012093	ABM	500 ng	EUR 329

DEDD Protein Vector (Human) (pPB-N-His)
PV012094	ABM	500 ng	EUR 329

DEDD Protein Vector (Human) (pPM-C-HA)
PV012095	ABM	500 ng	EUR 329

DEDD Protein Vector (Human) (pPM-C-His)
PV012096	ABM	500 ng	EUR 329

DEDD Protein Vector (Mouse) (pPB-C-His)
PV171330	ABM	500 ng	EUR 603

DEDD Protein Vector (Mouse) (pPB-N-His)
PV171331	ABM	500 ng	EUR 603

DEDD Protein Vector (Mouse) (pPM-C-HA)
PV171332	ABM	500 ng	EUR 603

DEDD Rabbit Polyclonal Antibody