FAM3B Rabbit Polyclonal Antibody

FAM3B Rabbit Polyclonal Antibody

FAM3B Polyclonal Antibody

A62562 100 µg
EUR 570.55
Description: The best epigenetics products

FAM3B Rabbit pAb

A1082-100ul 100 ul
EUR 308

FAM3B Rabbit pAb

A1082-200ul 200 ul
EUR 459

FAM3B Rabbit pAb

A1082-20ul 20 ul
EUR 183

FAM3B Rabbit pAb

A1082-50ul 50 ul
EUR 223

FAM3B Rabbit pAb

A13592-100ul 100 ul
EUR 308

FAM3B Rabbit pAb

A13592-200ul 200 ul
EUR 459

FAM3B Rabbit pAb

A13592-20ul 20 ul
EUR 183

FAM3B Rabbit pAb

A13592-50ul 50 ul
EUR 223

FAM3B Rabbit pAb

A14215-100ul 100 ul
EUR 308

FAM3B Rabbit pAb

A14215-200ul 200 ul
EUR 459

FAM3B Rabbit pAb

A14215-20ul 20 ul
EUR 183

FAM3B Rabbit pAb

A14215-50ul 50 ul
EUR 223

Protein FAM3B (FAM3B) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein FAM3B (FAM3B) Antibody

abx033046-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein FAM3B (FAM3B) Antibody

abx033046-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein FAM3B (FAM3B) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein FAM3B (FAM3B) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein FAM3B (FAM3B) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein FAM3B (FAM3B) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FAM3B Antibody

ABD6227 100 ug
EUR 438

FAM3B Antibody

36462-100ul 100ul
EUR 252

FAM3B antibody

38181-100ul 100ul
EUR 252

FAM3B antibody

70R-17219 50 ul
EUR 435
Description: Rabbit polyclonal FAM3B antibody

FAM3B Antibody

DF6227 200ul
EUR 304
Description: FAM3B Antibody detects endogenous levels of total FAM3B.

FAM3B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FAM3B. Recognizes FAM3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

FAM3B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAM3B. Recognizes FAM3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:3000, IHC:1:20-1:200

FAM3B Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FAM3B. Recognizes FAM3B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FAM3B Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FAM3B. Recognizes FAM3B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Polyclonal FAM3B Antibody (N-term)

AMM04508G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FAM3B (N-term). This antibody is tested and proven to work in the following applications:

FAM3B Polyclonal Antibody, HRP Conjugated

A62563 100 µg
EUR 570.55
Description: kits suitable for this type of research

FAM3B Polyclonal Antibody, FITC Conjugated

A62564 100 µg
EUR 570.55
Description: fast delivery possible

FAM3B Polyclonal Antibody, Biotin Conjugated

A62565 100 µg
EUR 570.55
Description: reagents widely cited

Human Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit

DLR-FAM3B-Hu-48T 48T
EUR 554
  • Should the Human Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Family With Sequence Similarity 3, Member B (FAM3B) in samples from serum, plasma or other biological fluids.

Human Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit

DLR-FAM3B-Hu-96T 96T
EUR 725
  • Should the Human Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Family With Sequence Similarity 3, Member B (FAM3B) in samples from serum, plasma or other biological fluids.

Mouse Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit

DLR-FAM3B-Mu-48T 48T
EUR 566
  • Should the Mouse Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Family With Sequence Similarity 3, Member B (FAM3B) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit

DLR-FAM3B-Mu-96T 96T
EUR 741
  • Should the Mouse Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Family With Sequence Similarity 3, Member B (FAM3B) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit

RD-FAM3B-Hu-48Tests 48 Tests
EUR 563

Human Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit

RD-FAM3B-Hu-96Tests 96 Tests
EUR 783

Mouse Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit

RD-FAM3B-Mu-48Tests 48 Tests
EUR 577

Mouse Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit

RD-FAM3B-Mu-96Tests 96 Tests
EUR 802

Human Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit

RDR-FAM3B-Hu-48Tests 48 Tests
EUR 589

Human Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit

RDR-FAM3B-Hu-96Tests 96 Tests
EUR 820

Mouse Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit

RDR-FAM3B-Mu-48Tests 48 Tests
EUR 603

Mouse Family With Sequence Similarity 3, Member B (FAM3B) ELISA Kit

RDR-FAM3B-Mu-96Tests 96 Tests
EUR 840

FAM3B Conjugated Antibody

C36462 100ul
EUR 397

Anti-FAM3B antibody

STJ23622 100 µl
EUR 277

Anti-FAM3B antibody

STJ115553 100 µl
EUR 277

Anti-FAM3B antibody

STJ116147 100 µl
EUR 277

Anti-FAM3B antibody

STJ192066 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FAM3B

Mouse Protein FAM3B (FAM3B) ELISA Kit

abx572538-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human FAM3B/ Protein FAM3B ELISA Kit

E2771Hu 1 Kit
EUR 571

Human FAM3B(Protein FAM3B) ELISA Kit

EH2234 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P58499
  • Alias: FAM3B/PANDER/PRED44/2-21/chromosome 21 open reading frame 11/Cytokine-like protein 2-21/family with sequence similarity 3, member B/ORF9/pancreatic derived factor/Pancreatic-derived factor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Protein FAM3B, FAM3B ELISA KIT

ELI-09859h 96 Tests
EUR 824

Mouse Protein FAM3B, Fam3b ELISA KIT

ELI-30781m 96 Tests
EUR 865

Human Protein FAM3B (FAM3B) ELISA Kit

abx251579-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Protein FAM3B(FAM3B) ELISA kit

CSB-EL008227HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3B (FAM3B) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein FAM3B(FAM3B) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3B(FAM3B) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19267 50 ug
EUR 363
Description: Mouse polyclonal to FAM3B


YF-PA19268 100 ug
EUR 403
Description: Rabbit polyclonal to FAM3B

Rabbit Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E04P0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E04P0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E04P0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FAM3B Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAM3B. Recognizes FAM3B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FAM3B Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAM3B. Recognizes FAM3B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FAM3B Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAM3B. Recognizes FAM3B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ELISA kit for Human Protein FAM3B (FAM3B)

KTE62394-48T 48T
EUR 332
  • The authors predicted that FAM3B forms a 4-helix bundle, and 3-dimensional modeling indicated that 4 cysteines could form 2 disulfide bonds linking helices 1 and 4 and helices 2 and 3. The human and mouse FAM3B proteins share 78% amino acid identity.
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein FAM3B (FAM3B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein FAM3B (FAM3B)

KTE62394-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The authors predicted that FAM3B forms a 4-helix bundle, and 3-dimensional modeling indicated that 4 cysteines could form 2 disulfide bonds linking helices 1 and 4 and helices 2 and 3. The human and mouse FAM3B proteins share 78% amino acid identity.
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein FAM3B (FAM3B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein FAM3B (FAM3B)

KTE62394-96T 96T
EUR 539
  • The authors predicted that FAM3B forms a 4-helix bundle, and 3-dimensional modeling indicated that 4 cysteines could form 2 disulfide bonds linking helices 1 and 4 and helices 2 and 3. The human and mouse FAM3B proteins share 78% amino acid identity.
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein FAM3B (FAM3B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Fam3b ELISA Kit| Mouse Protein FAM3B ELISA Kit

EF014869 96 Tests
EUR 689

FAM3B cloning plasmid

CSB-CL008227HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 708
  • Sequence: atgcgcccattggctggtggcctgctcaaggtggtgttcgtggtcttcgcctccttgtgtgcctggtattcggggtacctgctcgcagagctcattccagatgcacccctgtccagtgctgcctatagcatccgcagcatcggggagaggcctgtcctcaaagctccagtccccaa
  • Show more
Description: A cloning plasmid for the FAM3B gene.

FAM3B Blocking Peptide

DF6227-BP 1mg
EUR 195

Anti-FAM3B (1E7)

YF-MA11534 100 ug
EUR 363
Description: Mouse monoclonal to FAM3B

Mouse FAM3B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E2715h 96 Tests
EUR 824


EF006301 96 Tests
EUR 689

Human FAM3B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FAM3B Recombinant Protein (Human)

RP011530 100 ug Ask for price

FAM3B Recombinant Protein (Rat)

RP200636 100 ug Ask for price

FAM3B Recombinant Protein (Mouse)

RP133376 100 ug Ask for price

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Human)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Leu30~Ser187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member B (FAM3B)

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Mouse)

  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Glu30~Arg235)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Family With Sequence Similarity 3, Member B (FAM3B)

FAM3B ORF Vector (Human) (pORF)

ORF003844 1.0 ug DNA
EUR 95

Fam3b ORF Vector (Rat) (pORF)

ORF066880 1.0 ug DNA
EUR 506

Fam3b ORF Vector (Mouse) (pORF)

ORF044460 1.0 ug DNA
EUR 506

FAM3B ELISA Kit (Human) (OKAN05562)

OKAN05562 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.255 ng/mL

FAM3B ELISA Kit (Mouse) (OKCD02538)

OKCD02538 96 Wells
EUR 936
Description: Description of target: Induces apoptosis of alpha and beta cells in a dose- and time-dependent manner.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.124 ng/mL

FAM3B ELISA Kit (Human) (OKCD09309)

OKCD09309 96 Wells
EUR 909
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.255ng/mL

FAM3B ELISA Kit (Human) (OKEH01662)

OKEH01662 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.19 ng/mL

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Human), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Leu30~Ser187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with APC.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Human), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Leu30~Ser187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with Biotin.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Human), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Leu30~Ser187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with Cy3.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Human), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Leu30~Ser187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with FITC.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Human), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Leu30~Ser187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with HRP.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Human), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Leu30~Ser187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with PE.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Mouse), APC

  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Glu30~Arg235)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with APC.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Glu30~Arg235)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with Biotin.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Mouse), Cy3

  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Glu30~Arg235)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with Cy3.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Mouse), FITC

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Glu30~Arg235)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with FITC.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Mouse), HRP

  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Glu30~Arg235)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with HRP.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Mouse), PE

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Glu30~Arg235)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with PE.

Rat Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E02P0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E02P0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E02P0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E03P0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E03P0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E03P0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E01P0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E01P0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E01P0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E06P0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E06P0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E06P0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E07P0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E07P0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E07P0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E08P0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E08P0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E08P0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E09P0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E09P0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E09P0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Human), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Leu30~Ser187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with APC-Cy7.

Family With Sequence Similarity 3, Member B (FAM3B) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3B (Glu30~Arg235)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Family With Sequence Similarity 3, Member B (FAM3B). This antibody is labeled with APC-Cy7.

ELISA kit for Human Protein FAM3B

EK4536 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein FAM3B in samples from serum, plasma, tissue homogenates and other biological fluids.

Fam3b sgRNA CRISPR Lentivector set (Mouse)

K4424401 3 x 1.0 ug
EUR 339

FAM3B sgRNA CRISPR Lentivector set (Human)

K0712401 3 x 1.0 ug
EUR 339

Fam3b sgRNA CRISPR Lentivector set (Rat)

K6681701 3 x 1.0 ug
EUR 339

Guinea pig Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E05P0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E05P0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Pancreatic Derived Factor/FAM3B Antibody ELISA kit

E05P0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Pancreatic Derived Factor/FAM3B Antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Family With Sequence Similarity 3, Member B (FAM3B) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member B (FAM3B) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Family With Sequence Similarity 3, Member B (FAM3B) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Family With Sequence Similarity 3, Member B (FAM3B) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Family With Sequence Similarity 3, Member B (FAM3B) Antibody

  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Family With Sequence Similarity 3, Member B (FAM3B) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member B (FAM3B) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fam3b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4424402 1.0 ug DNA
EUR 154

Fam3b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4424403 1.0 ug DNA
EUR 154

Fam3b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4424404 1.0 ug DNA
EUR 154

FAM3B sgRNA CRISPR Lentivector (Human) (Target 1)

K0712402 1.0 ug DNA
EUR 154

FAM3B sgRNA CRISPR Lentivector (Human) (Target 2)

K0712403 1.0 ug DNA
EUR 154

FAM3B sgRNA CRISPR Lentivector (Human) (Target 3)

K0712404 1.0 ug DNA
EUR 154

Fam3b sgRNA CRISPR Lentivector (Rat) (Target 1)

K6681702 1.0 ug DNA
EUR 154

Fam3b sgRNA CRISPR Lentivector (Rat) (Target 2)

K6681703 1.0 ug DNA
EUR 154

Fam3b sgRNA CRISPR Lentivector (Rat) (Target 3)

K6681704 1.0 ug DNA
EUR 154

FAM3B Protein Vector (Mouse) (pPB-C-His)

PV177838 500 ng
EUR 603

FAM3B Protein Vector (Mouse) (pPB-N-His)

PV177839 500 ng
EUR 603

FAM3B Protein Vector (Mouse) (pPM-C-HA)

PV177840 500 ng
EUR 603

FAM3B Protein Vector (Mouse) (pPM-C-His)

PV177841 500 ng
EUR 603

Recombinant Human FAM3B Protein, His, E.coli-10ug

QP11845-10ug 10ug
EUR 201

Recombinant Human FAM3B Protein, His, E.coli-1mg

QP11845-1mg 1mg
EUR 5251

Recombinant Human FAM3B Protein, His, E.coli-2ug

QP11845-2ug 2ug
EUR 155

FAM3B Protein Vector (Human) (pPB-C-His)

PV015373 500 ng
EUR 329

FAM3B Protein Vector (Human) (pPB-N-His)

PV015374 500 ng
EUR 329

FAM3B Protein Vector (Human) (pPM-C-HA)

PV015375 500 ng
EUR 329

FAM3B Protein Vector (Human) (pPM-C-His)

PV015376 500 ng
EUR 329

FAM3B Protein Vector (Rat) (pPB-C-His)

PV267518 500 ng
EUR 603

FAM3B Protein Vector (Rat) (pPB-N-His)

PV267519 500 ng
EUR 603

FAM3B Protein Vector (Rat) (pPM-C-HA)

PV267520 500 ng
EUR 603

FAM3B Protein Vector (Rat) (pPM-C-His)

PV267521 500 ng
EUR 603

Fam3b 3'UTR Luciferase Stable Cell Line

TU204362 1.0 ml Ask for price

FAM3B Rabbit Polyclonal Antibody