FCN1 Rabbit Polyclonal Antibody

FCN1 Rabbit Polyclonal Antibody

FCN1 Polyclonal Antibody

ABP58537-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FCN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FCN1 from Human, Mouse, Rat. This FCN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCN1 protein

Human Ficolin 1 (FCN1) ELISA Kit

DLR-FCN1-Hu-48T 48T
EUR 479
  • Should the Human Ficolin 1 (FCN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ficolin 1 (FCN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ficolin 1 (FCN1) ELISA Kit

DLR-FCN1-Hu-96T 96T
EUR 621
  • Should the Human Ficolin 1 (FCN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ficolin 1 (FCN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Ficolin 1 (FCN1) ELISA Kit

DLR-FCN1-Mu-48T 48T
EUR 489
  • Should the Mouse Ficolin 1 (FCN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Ficolin 1 (FCN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Ficolin 1 (FCN1) ELISA Kit

DLR-FCN1-Mu-96T 96T
EUR 635
  • Should the Mouse Ficolin 1 (FCN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Ficolin 1 (FCN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Ficolin 1 (FCN1) ELISA Kit

DLR-FCN1-Ra-48T 48T
EUR 508
  • Should the Rat Ficolin 1 (FCN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ficolin 1 (FCN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Ficolin 1 (FCN1) ELISA Kit

DLR-FCN1-Ra-96T 96T
EUR 661
  • Should the Rat Ficolin 1 (FCN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ficolin 1 (FCN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Ficolin 1 (FCN1) ELISA Kit

RD-FCN1-Hu-48Tests 48 Tests
EUR 478

Human Ficolin 1 (FCN1) ELISA Kit

RD-FCN1-Hu-96Tests 96 Tests
EUR 662

Mouse Ficolin 1 (FCN1) ELISA Kit

RD-FCN1-Mu-48Tests 48 Tests
EUR 489

Mouse Ficolin 1 (FCN1) ELISA Kit

RD-FCN1-Mu-96Tests 96 Tests
EUR 677

Rat Ficolin 1 (FCN1) ELISA Kit

RD-FCN1-Ra-48Tests 48 Tests
EUR 511

Rat Ficolin 1 (FCN1) ELISA Kit

RD-FCN1-Ra-96Tests 96 Tests
EUR 709

Human Ficolin 1 (FCN1) ELISA Kit

RDR-FCN1-Hu-48Tests 48 Tests
EUR 500

Human Ficolin 1 (FCN1) ELISA Kit

RDR-FCN1-Hu-96Tests 96 Tests
EUR 692

Mouse Ficolin 1 (FCN1) ELISA Kit

RDR-FCN1-Mu-48Tests 48 Tests
EUR 511

Mouse Ficolin 1 (FCN1) ELISA Kit

RDR-FCN1-Mu-96Tests 96 Tests
EUR 709

Rat Ficolin 1 (FCN1) ELISA Kit

RDR-FCN1-Ra-48Tests 48 Tests
EUR 534

Rat Ficolin 1 (FCN1) ELISA Kit

RDR-FCN1-Ra-96Tests 96 Tests
EUR 742

FCN1 Rabbit pAb

A6587-100ul 100 ul
EUR 308

FCN1 Rabbit pAb

A6587-200ul 200 ul
EUR 459

FCN1 Rabbit pAb

A6587-20ul 20 ul
EUR 183

FCN1 Rabbit pAb

A6587-50ul 50 ul
EUR 223

FCN1 antibody

70R-5405 50 ug
EUR 467
Description: Rabbit polyclonal FCN1 antibody

FCN1 antibody

70R-9277 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal FCN1 antibody

FCN1 antibody

39027-100ul 100ul
EUR 252

FCN1 Antibody

40043-100ul 100ul
EUR 390

FCN1 antibody

70R-17273 50 ul
EUR 435
Description: Rabbit polyclonal FCN1 antibody

FCN1 Antibody

1-CSB-PA008550ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FCN1. Recognizes FCN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FCN1 Antibody

1-CSB-PA008550GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FCN1. Recognizes FCN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Ficolin 1 (FCN1) Polyclonal Antibody (Human)

4-PAA786Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1)

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse)

4-PAA786Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1)

Ficolin 1 (FCN1) Polyclonal Antibody (Rat)

4-PAA786Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1)

FCN1 Conjugated Antibody

C39027 100ul
EUR 397

anti- FCN1 antibody

FNab03060 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ficolin (collagen/fibrinogen domain containing) 1
  • Uniprot ID: O00602
  • Gene ID: 2219
  • Research Area: Cancer, Immunology, Signal Transduction
Description: Antibody raised against FCN1

Anti-FCN1 antibody

PAab03060 100 ug
EUR 412

Anti-FCN1 antibody

STJ28670 100 µl
EUR 277
Description: The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity.

Anti-FCN1 antibody

STJ192065 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FCN1

Fcn1/ Rat Fcn1 ELISA Kit

ELI-04973r 96 Tests
EUR 886

Ficolin 1 (FCN1) Polyclonal Antibody (Human), APC

4-PAA786Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with APC.

Ficolin 1 (FCN1) Polyclonal Antibody (Human), Biotinylated

4-PAA786Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with Biotin.

Ficolin 1 (FCN1) Polyclonal Antibody (Human), Cy3

4-PAA786Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with Cy3.

Ficolin 1 (FCN1) Polyclonal Antibody (Human), FITC

4-PAA786Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with FITC.

Ficolin 1 (FCN1) Polyclonal Antibody (Human), HRP

4-PAA786Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with HRP.

Ficolin 1 (FCN1) Polyclonal Antibody (Human), PE

4-PAA786Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with PE.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), APC

4-PAA786Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with APC.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), Biotinylated

4-PAA786Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with Biotin.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), Cy3

4-PAA786Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with Cy3.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), FITC

4-PAA786Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with FITC.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), HRP

4-PAA786Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with HRP.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), PE

4-PAA786Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with PE.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), APC

4-PAA786Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with APC.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), Biotinylated

4-PAA786Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with Biotin.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), Cy3

4-PAA786Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with Cy3.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), FITC

4-PAA786Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with FITC.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), HRP

4-PAA786Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with HRP.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), PE

4-PAA786Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with PE.

Rabbit Ficolin 1 (FCN1) ELISA Kit

abx363588-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Ficolin 1(FCN1) ELISA kit

E04F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ficolin 1(FCN1) ELISA kit

E04F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ficolin 1(FCN1) ELISA kit

E04F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FCN1 siRNA

20-abx916706
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FCN1 siRNA

20-abx916707
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-FCN1

YF-PA11741 50 ul
EUR 363
Description: Mouse polyclonal to FCN1

anti-FCN1

YF-PA11742 50 ug
EUR 363
Description: Mouse polyclonal to FCN1

anti-FCN1

YF-PA11743 100 ul
EUR 403
Description: Rabbit polyclonal to FCN1

anti-FCN1

YF-PA11744 100 ug
EUR 403
Description: Rabbit polyclonal to FCN1

Ficolin 1 (FCN1) Antibody

20-abx112538
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

20-abx130259
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ficolin 1 (FCN1) Antibody

abx036569-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

20-abx100334
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ficolin 1 (FCN1) Antibody

20-abx100335
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ficolin 1 (FCN1) Antibody

20-abx005053
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

abx029230-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

abx029230-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

20-abx172436
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ficolin 1 (FCN1) Antibody

20-abx172437
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ficolin 1 (FCN1) Antibody

20-abx176471
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ficolin 1 (FCN1) Antibody

20-abx320734
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

20-abx225168
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

abx233060-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ficolin 1 (FCN1) Polyclonal Antibody (Human), APC-Cy7

4-PAA786Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with APC-Cy7.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAA786Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with APC-Cy7.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), APC-Cy7

4-PAA786Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with APC-Cy7.

FCN1 cloning plasmid

CSB-CL008550HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 981
  • Sequence: atggagctgagtggagccaccatggcccggggtctcgctgtcctgctagtcttgttcctgcatatcaagaacctgcctgcccaggctgcggacacatgtccagaggtgaaggtggtgggcctggagggctctgacaagctcaccattctccgaggctgcccggggctgcccggggc
  • Show more
Description: A cloning plasmid for the FCN1 gene.

FCN1 Blocking Peptide

33R-3578 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FCN1 antibody, catalog no. 70R-5405

FCN1 Blocking Peptide

33R-3820 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FCN1 antibody, catalog no. 70R-9277

Anti-FCN1 (2B7)

YF-MA12977 100 ug
EUR 363
Description: Mouse monoclonal to FCN1

Ficolin 1 (FCN1) Antibody Pair

20-abx370490
  • EUR 1706.00
  • EUR 1094.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Human FCN1 ELISA Kit

ELA-E1506h 96 Tests
EUR 824

FCN1 ELISA KIT|Human

EF000107 96 Tests
EUR 689

Human FCN1 shRNA Plasmid

20-abx951552
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FCN1 shRNA Plasmid

20-abx970302
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Ficolin 1 (FCN1)

4-RPA786Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00602
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.7kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human Ficolin 1 expressed in: E.coli

Recombinant Ficolin 1 (FCN1)

4-RPA786Mu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O70165
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.5kDa
  • Isoelectric Point: 6.3
Description: Recombinant Mouse Ficolin 1 expressed in: E.coli

Recombinant Ficolin 1 (FCN1)

4-RPA786Ra01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9WTS8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.2kDa
  • Isoelectric Point: 7.7
Description: Recombinant Rat Ficolin 1 expressed in: E.coli

FCN1 Recombinant Protein (Human)

RP012016 100 ug Ask for price

FCN1 Recombinant Protein (Rat)

RP201143 100 ug Ask for price

Monoclonal FCN1 Antibody (monoclonal) (M06), Clone: 2B7

AMM03537G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human FCN1 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 2B7. This antibody is applicable in WB, E

Human Ficolin 1 (FCN1) Protein

20-abx066652
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Ficolin 1 (FCN1) Protein

20-abx066653
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Ficolin 1 (FCN1) Protein

20-abx168501
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

FCN1 ORF Vector (Human) (pORF)

ORF004006 1.0 ug DNA
EUR 95

Fcn1 ORF Vector (Rat) (pORF)

ORF067049 1.0 ug DNA
EUR 506

Pig Ficolin 1 (FCN1) ELISA Kit

abx360536-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Ficolin 1 (FCN1) ELISA Kit

abx364364-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Human Ficolin 1 (FCN1) ELISA Kit

abx570614-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Ficolin 1 (FCN1) ELISA Kit

abx573209-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Ficolin 1 (FCN1) ELISA Kit

abx573581-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Goat Ficolin 1(FCN1) ELISA kit

E06F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ficolin 1(FCN1) ELISA kit

E06F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ficolin 1(FCN1) ELISA kit

E06F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ficolin 1(FCN1) ELISA kit

E02F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ficolin 1(FCN1) ELISA kit

E02F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ficolin 1(FCN1) ELISA kit

E02F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ficolin 1(FCN1) ELISA kit

E03F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ficolin 1(FCN1) ELISA kit

E03F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ficolin 1(FCN1) ELISA kit

E03F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Fcn1/ Ficolin-1 ELISA Kit

E0354Ra 1 Kit
EUR 571

Human Ficolin 1(FCN1) ELISA kit

E01F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ficolin 1(FCN1) ELISA kit

E01F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ficolin 1(FCN1) ELISA kit

E01F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FCN1/ Ficolin-1 ELISA Kit

E0883Hu 1 Kit
EUR 571

Dog Ficolin 1(FCN1) ELISA kit

E08F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ficolin 1(FCN1) ELISA kit

E08F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ficolin 1(FCN1) ELISA kit

E08F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ficolin 1(FCN1) ELISA kit

E07F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ficolin 1(FCN1) ELISA kit

E07F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ficolin 1(FCN1) ELISA kit

E07F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ficolin 1(FCN1) ELISA kit

E09F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ficolin 1(FCN1) ELISA kit

E09F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ficolin 1(FCN1) ELISA kit

E09F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FCN1(Ficolin-1) ELISA Kit

EH0135 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O00602
  • Alias: Ficolin-1/FCN1/FCNM/M-ficolin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Porcine Ficolin- 1, FCN1 ELISA KIT

ELI-04972p 96 Tests
EUR 928

Human Ficolin- 1, FCN1 ELISA KIT

ELI-04974h 96 Tests
EUR 824

Mouse Ficolin- 1, Fcn1 ELISA KIT

ELI-04975m 96 Tests
EUR 865

FCN1 sgRNA CRISPR Lentivector set (Human)

K0770401 3 x 1.0 ug
EUR 339

Rat Ficolin 1 (FCN1) ELISA Kit

20-abx155538
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Ficolin 1 (FCN1) ELISA Kit

20-abx154026
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ficolin 1 (FCN1) ELISA Kit

20-abx151552
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Ficolin 1 (FCN1) CLIA Kit

20-abx190721
  • EUR 8443.00
  • EUR 4497.00
  • EUR 1036.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ficolin 1 (FCN1) CLIA Kit

abx195616-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Ficolin 1 (FCN1) ELISA Kit

abx359030-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Ficolin 1 (FCN1) ELISA Kit

abx355728-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Ficolin 1 (FCN1) CLIA Kit

20-abx492034
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Ficolin 1 (FCN1) CLIA Kit

20-abx492035
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Ficolin 1 (FCN1) ELISA Kit

abx250619-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Ficolin-1(FCN1) ELISA kit

CSB-EL008550MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ficolin-1 (FCN1) in samples from serum, plasma, tissue homogenates . A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Ficolin-1(FCN1) ELISA kit

1-CSB-EL008550MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ficolin-1(FCN1) in samples from serum, plasma, tissue homogenates . Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig FCN1/ Ficolin-1 ELISA Kit

E0062Pi 1 Kit
EUR 717

Fcn1 sgRNA CRISPR Lentivector set (Rat)

K7002601 3 x 1.0 ug
EUR 339

Human Ficolin 1 (FCN1) ELISA Kit

SEA786Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Ficolin 1 (FCN1) ELISA Kit

SEA786Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Ficolin 1 (FCN1) ELISA Kit

SEA786Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Ficolin 1 (FCN1) ELISA Kit

SEA786Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Ficolin 1 (FCN1) ELISA Kit

4-SEA786Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ficolin 1 elisa. Alternative names of the recognized antigen: FCNM
  • Collagen/fibrinogen domain-containing protein 1
  • Ficolin-alpha
  • Ficolin-A
  • M-ficolin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ficolin 1 (FCN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Ficolin 1 (FCN1) ELISA Kit

SEA786Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Ficolin 1 (FCN1) ELISA Kit

SEA786Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Ficolin 1 (FCN1) ELISA Kit

SEA786Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Ficolin 1 (FCN1) ELISA Kit

SEA786Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Ficolin 1 (FCN1) ELISA Kit

4-SEA786Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ficolin 1 elisa. Alternative names of the recognized antigen: FCNM
  • Collagen/fibrinogen domain-containing protein 1
  • Ficolin-alpha
  • Ficolin-A
  • M-ficolin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Ficolin 1 (FCN1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Ficolin 1 (FCN1) ELISA Kit

SEA786Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Ficolin 1 (FCN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Ficolin 1 (FCN1) ELISA Kit

SEA786Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Ficolin 1 (FCN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Ficolin 1 (FCN1) ELISA Kit

SEA786Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Ficolin 1 (FCN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

FCN1 Rabbit Polyclonal Antibody