FCN1 Rabbit Polyclonal Antibody

FCN1 Rabbit Polyclonal Antibody

FCN1 Polyclonal Antibody

ABP58537-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FCN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FCN1 from Human, Mouse, Rat. This FCN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCN1 protein

Human Ficolin 1 (FCN1) ELISA Kit

DLR-FCN1-Hu-48T 48T
EUR 479
  • Should the Human Ficolin 1 (FCN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ficolin 1 (FCN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ficolin 1 (FCN1) ELISA Kit

DLR-FCN1-Hu-96T 96T
EUR 621
  • Should the Human Ficolin 1 (FCN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ficolin 1 (FCN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Ficolin 1 (FCN1) ELISA Kit

DLR-FCN1-Mu-48T 48T
EUR 489
  • Should the Mouse Ficolin 1 (FCN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Ficolin 1 (FCN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Ficolin 1 (FCN1) ELISA Kit

DLR-FCN1-Mu-96T 96T
EUR 635
  • Should the Mouse Ficolin 1 (FCN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Ficolin 1 (FCN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Ficolin 1 (FCN1) ELISA Kit

DLR-FCN1-Ra-48T 48T
EUR 508
  • Should the Rat Ficolin 1 (FCN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ficolin 1 (FCN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Ficolin 1 (FCN1) ELISA Kit

DLR-FCN1-Ra-96T 96T
EUR 661
  • Should the Rat Ficolin 1 (FCN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ficolin 1 (FCN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Ficolin 1 (FCN1) ELISA Kit

RD-FCN1-Hu-48Tests 48 Tests
EUR 478

Human Ficolin 1 (FCN1) ELISA Kit

RD-FCN1-Hu-96Tests 96 Tests
EUR 662

Mouse Ficolin 1 (FCN1) ELISA Kit

RD-FCN1-Mu-48Tests 48 Tests
EUR 489

Mouse Ficolin 1 (FCN1) ELISA Kit

RD-FCN1-Mu-96Tests 96 Tests
EUR 677

Rat Ficolin 1 (FCN1) ELISA Kit

RD-FCN1-Ra-48Tests 48 Tests
EUR 511

Rat Ficolin 1 (FCN1) ELISA Kit

RD-FCN1-Ra-96Tests 96 Tests
EUR 709

Human Ficolin 1 (FCN1) ELISA Kit

RDR-FCN1-Hu-48Tests 48 Tests
EUR 500

Human Ficolin 1 (FCN1) ELISA Kit

RDR-FCN1-Hu-96Tests 96 Tests
EUR 692

Mouse Ficolin 1 (FCN1) ELISA Kit

RDR-FCN1-Mu-48Tests 48 Tests
EUR 511

Mouse Ficolin 1 (FCN1) ELISA Kit

RDR-FCN1-Mu-96Tests 96 Tests
EUR 709

Rat Ficolin 1 (FCN1) ELISA Kit

RDR-FCN1-Ra-48Tests 48 Tests
EUR 534

Rat Ficolin 1 (FCN1) ELISA Kit

RDR-FCN1-Ra-96Tests 96 Tests
EUR 742

FCN1 Rabbit pAb

A6587-100ul 100 ul
EUR 308

FCN1 Rabbit pAb

A6587-200ul 200 ul
EUR 459

FCN1 Rabbit pAb

A6587-20ul 20 ul
EUR 183

FCN1 Rabbit pAb

A6587-50ul 50 ul
EUR 223

FCN1 antibody

70R-5405 50 ug
EUR 467
Description: Rabbit polyclonal FCN1 antibody

FCN1 antibody

70R-9277 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal FCN1 antibody

FCN1 antibody

39027-100ul 100ul
EUR 252

FCN1 Antibody

40043-100ul 100ul
EUR 390

FCN1 antibody

70R-17273 50 ul
EUR 435
Description: Rabbit polyclonal FCN1 antibody

FCN1 Antibody

1-CSB-PA008550ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FCN1. Recognizes FCN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FCN1 Antibody

1-CSB-PA008550GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FCN1. Recognizes FCN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Ficolin 1 (FCN1) Polyclonal Antibody (Human)

4-PAA786Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1)

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse)

4-PAA786Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1)

Ficolin 1 (FCN1) Polyclonal Antibody (Rat)

4-PAA786Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1)

FCN1 Conjugated Antibody

C39027 100ul
EUR 397

anti- FCN1 antibody

FNab03060 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ficolin (collagen/fibrinogen domain containing) 1
  • Uniprot ID: O00602
  • Gene ID: 2219
  • Research Area: Cancer, Immunology, Signal Transduction
Description: Antibody raised against FCN1

Anti-FCN1 antibody

PAab03060 100 ug
EUR 412

Anti-FCN1 antibody

STJ28670 100 µl
EUR 277
Description: The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity.

Anti-FCN1 antibody

STJ192065 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FCN1

Fcn1/ Rat Fcn1 ELISA Kit

ELI-04973r 96 Tests
EUR 886

Ficolin 1 (FCN1) Polyclonal Antibody (Human), APC

4-PAA786Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with APC.

Ficolin 1 (FCN1) Polyclonal Antibody (Human), Biotinylated

4-PAA786Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with Biotin.

Ficolin 1 (FCN1) Polyclonal Antibody (Human), Cy3

4-PAA786Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with Cy3.

Ficolin 1 (FCN1) Polyclonal Antibody (Human), FITC

4-PAA786Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with FITC.

Ficolin 1 (FCN1) Polyclonal Antibody (Human), HRP

4-PAA786Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with HRP.

Ficolin 1 (FCN1) Polyclonal Antibody (Human), PE

4-PAA786Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with PE.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), APC

4-PAA786Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with APC.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), Biotinylated

4-PAA786Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with Biotin.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), Cy3

4-PAA786Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with Cy3.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), FITC

4-PAA786Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with FITC.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), HRP

4-PAA786Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with HRP.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), PE

4-PAA786Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with PE.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), APC

4-PAA786Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with APC.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), Biotinylated

4-PAA786Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with Biotin.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), Cy3

4-PAA786Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with Cy3.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), FITC

4-PAA786Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with FITC.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), HRP

4-PAA786Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with HRP.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), PE

4-PAA786Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with PE.

Rabbit Ficolin 1 (FCN1) ELISA Kit

abx363588-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Ficolin 1(FCN1) ELISA kit

E04F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ficolin 1(FCN1) ELISA kit

E04F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ficolin 1(FCN1) ELISA kit

E04F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FCN1 siRNA

20-abx916706
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FCN1 siRNA

20-abx916707
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-FCN1

YF-PA11741 50 ul
EUR 363
Description: Mouse polyclonal to FCN1

anti-FCN1

YF-PA11742 50 ug
EUR 363
Description: Mouse polyclonal to FCN1

anti-FCN1

YF-PA11743 100 ul
EUR 403
Description: Rabbit polyclonal to FCN1

anti-FCN1

YF-PA11744 100 ug
EUR 403
Description: Rabbit polyclonal to FCN1

Ficolin 1 (FCN1) Antibody

20-abx112538
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

20-abx130259
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ficolin 1 (FCN1) Antibody

abx036569-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

20-abx100334
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ficolin 1 (FCN1) Antibody

20-abx100335
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ficolin 1 (FCN1) Antibody

20-abx005053
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

abx029230-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

abx029230-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

20-abx172436
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ficolin 1 (FCN1) Antibody

20-abx172437
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ficolin 1 (FCN1) Antibody

20-abx176471
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ficolin 1 (FCN1) Antibody

20-abx320734
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

20-abx225168
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ficolin 1 (FCN1) Antibody

abx233060-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ficolin 1 (FCN1) Polyclonal Antibody (Human), APC-Cy7

4-PAA786Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Asp45~Thr249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Ficolin 1 (FCN1). This antibody is labeled with APC-Cy7.

Ficolin 1 (FCN1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAA786Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Arg25~Gly317)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ficolin 1 (FCN1). This antibody is labeled with APC-Cy7.

Ficolin 1 (FCN1) Polyclonal Antibody (Rat), APC-Cy7

4-PAA786Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FCN1 (Ser25~Cys279)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ficolin 1 (FCN1). This antibody is labeled with APC-Cy7.

FCN1 cloning plasmid

CSB-CL008550HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 981
  • Sequence: atggagctgagtggagccaccatggcccggggtctcgctgtcctgctagtcttgttcctgcatatcaagaacctgcctgcccaggctgcggacacatgtccagaggtgaaggtggtgggcctggagggctctgacaagctcaccattctccgaggctgcccggggctgcccggggc
  • Show more
Description: A cloning plasmid for the FCN1 gene.

FCN1 Blocking Peptide

33R-3578 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FCN1 antibody, catalog no. 70R-5405

FCN1 Blocking Peptide

33R-3820 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FCN1 antibody, catalog no. 70R-9277

Anti-FCN1 (2B7)

YF-MA12977 100 ug
EUR 363
Description: Mouse monoclonal to FCN1

Ficolin 1 (FCN1) Antibody Pair

20-abx370490
  • EUR 1706.00
  • EUR 1094.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Human FCN1 ELISA Kit

ELA-E1506h 96 Tests
EUR 824

FCN1 ELISA KIT|Human

EF000107 96 Tests
EUR 689

Human FCN1 shRNA Plasmid

20-abx951552
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FCN1 shRNA Plasmid

20-abx970302
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Ficolin 1 (FCN1)

4-RPA786Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00602
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.7kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human Ficolin 1 expressed in: E.coli

Recombinant Ficolin 1 (FCN1)

4-RPA786Mu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O70165
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.5kDa
  • Isoelectric Point: 6.3
Description: Recombinant Mouse Ficolin 1 expressed in: E.coli

Recombinant Ficolin 1 (FCN1)

4-RPA786Ra01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9WTS8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.2kDa
  • Isoelectric Point: 7.7
Description: Recombinant Rat Ficolin 1 expressed in: E.coli

FCN1 Recombinant Protein (Human)

RP012016 100 ug Ask for price

FCN1 Recombinant Protein (Rat)

RP201143 100 ug Ask for price

Monoclonal FCN1 Antibody (monoclonal) (M06), Clone: 2B7

AMM03537G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human FCN1 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 2B7. This antibody is applicable in WB, E

Human Ficolin 1 (FCN1) Protein

20-abx066652
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Ficolin 1 (FCN1) Protein

20-abx066653
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Ficolin 1 (FCN1) Protein

20-abx168501
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

FCN1 ORF Vector (Human) (pORF)

ORF004006 1.0 ug DNA
EUR 95

Fcn1 ORF Vector (Rat) (pORF)

ORF067049 1.0 ug DNA
EUR 506

FCN1 ELISA Kit (Human) (OKAN04993)

OKAN04993 96 Wells
EUR 792
Description: Description of target: The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.066 ng/mL

FCN1 ELISA Kit (Human) (OKCD06818)

OKCD06818 96 Wells
EUR 753
Description: Description of target: The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1(FCN1) is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity.The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.066ng/mL

FCN1 ELISA Kit (Rat) (OKCD06819)

OKCD06819 96 Wells
EUR 818
Description: Description of target: Extracellular lectin functioning as a pattern-recognition receptor in innate immunity. Binds the sugar moieties of pathogen-associated molecular patterns (PAMPs) displayed on microbes and activates the lectin pathway of the complement system. May also activate monocytes through a G protein-coupled receptor, FFAR2, inducing the secretion of interleukin-8/IL-8. Binds preferentially to 9-O-acetylated 2-6-linked sialic acid derivatives and to various glycans containing sialic acid engaged in a 2-3 linkage.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 1.9ng/mL

FCN1 ELISA Kit (Rat) (OKEH03378)

OKEH03378 96 Wells
EUR 662
Description: Description of target: Extracellular lectin functioning as a pattern-recognition receptor in innate immunity. Binds the sugar moieties of pathogen-associated molecular patterns (PAMPs) displayed on microbes and activates the lectin pathway of the complement system. May also activate monocytes through a G protein-coupled receptor, FFAR2, inducing the secretion of interleukin-8/IL-8. Binds preferentially to 9-O-acetylated 2-6-linked sialic acid derivatives and to various glycans containing sialic acid engaged in a 2-3 linkage.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

FCN1 ELISA Kit (Human) (OKEH04203)

OKEH04203 96 Wells
EUR 662
Description: Description of target: The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

FCN1 ELISA Kit (Pig) (OKEH08136)

OKEH08136 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

Pig Ficolin 1 (FCN1) ELISA Kit

abx360536-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Ficolin 1 (FCN1) ELISA Kit

abx364364-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Human Ficolin 1 (FCN1) ELISA Kit

abx570614-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Ficolin 1 (FCN1) ELISA Kit

abx573209-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Ficolin 1 (FCN1) ELISA Kit

abx573581-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Goat Ficolin 1(FCN1) ELISA kit

E06F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ficolin 1(FCN1) ELISA kit

E06F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ficolin 1(FCN1) ELISA kit

E06F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ficolin 1(FCN1) ELISA kit

E02F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ficolin 1(FCN1) ELISA kit

E02F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ficolin 1(FCN1) ELISA kit

E02F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ficolin 1(FCN1) ELISA kit

E03F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ficolin 1(FCN1) ELISA kit

E03F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ficolin 1(FCN1) ELISA kit

E03F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Fcn1/ Ficolin-1 ELISA Kit

E0354Ra 1 Kit
EUR 571

Human Ficolin 1(FCN1) ELISA kit

E01F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ficolin 1(FCN1) ELISA kit

E01F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ficolin 1(FCN1) ELISA kit

E01F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FCN1/ Ficolin-1 ELISA Kit

E0883Hu 1 Kit
EUR 571

Dog Ficolin 1(FCN1) ELISA kit

E08F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ficolin 1(FCN1) ELISA kit

E08F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ficolin 1(FCN1) ELISA kit

E08F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ficolin 1(FCN1) ELISA kit

E07F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ficolin 1(FCN1) ELISA kit

E07F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ficolin 1(FCN1) ELISA kit

E07F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ficolin 1(FCN1) ELISA kit

E09F0364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ficolin 1(FCN1) ELISA kit

E09F0364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ficolin 1(FCN1) ELISA kit

E09F0364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ficolin 1(FCN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FCN1(Ficolin-1) ELISA Kit

EH0135 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O00602
  • Alias: Ficolin-1/FCN1/FCNM/M-ficolin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Porcine Ficolin- 1, FCN1 ELISA KIT

ELI-04972p 96 Tests
EUR 928

Human Ficolin- 1, FCN1 ELISA KIT

ELI-04974h 96 Tests
EUR 824

Mouse Ficolin- 1, Fcn1 ELISA KIT

ELI-04975m 96 Tests
EUR 865

FCN1 sgRNA CRISPR Lentivector set (Human)

K0770401 3 x 1.0 ug
EUR 339

Rat Ficolin 1 (FCN1) ELISA Kit

20-abx155538
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Ficolin 1 (FCN1) ELISA Kit

20-abx154026
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ficolin 1 (FCN1) ELISA Kit

20-abx151552
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Ficolin 1 (FCN1) CLIA Kit

20-abx190721
  • EUR 8443.00
  • EUR 4497.00
  • EUR 1036.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ficolin 1 (FCN1) CLIA Kit

abx195616-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Ficolin 1 (FCN1) ELISA Kit

abx359030-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Ficolin 1 (FCN1) ELISA Kit

abx355728-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Ficolin 1 (FCN1) CLIA Kit

20-abx492034
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Ficolin 1 (FCN1) CLIA Kit

20-abx492035
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Ficolin 1 (FCN1) ELISA Kit

abx250619-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Ficolin-1(FCN1) ELISA kit

CSB-EL008550MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ficolin-1 (FCN1) in samples from serum, plasma, tissue homogenates . A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Ficolin-1(FCN1) ELISA kit

1-CSB-EL008550MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ficolin-1(FCN1) in samples from serum, plasma, tissue homogenates . Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig FCN1/ Ficolin-1 ELISA Kit

E0062Pi 1 Kit
EUR 717

Fcn1 sgRNA CRISPR Lentivector set (Rat)

K7002601 3 x 1.0 ug
EUR 339

Human Ficolin 1 (FCN1) ELISA Kit

SEA786Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Ficolin 1 (FCN1) ELISA Kit

SEA786Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Ficolin 1 (FCN1) ELISA Kit

SEA786Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Ficolin 1 (FCN1) ELISA Kit

SEA786Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Ficolin 1 (FCN1) ELISA Kit

4-SEA786Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ficolin 1 elisa. Alternative names of the recognized antigen: FCNM
  • Collagen/fibrinogen domain-containing protein 1
  • Ficolin-alpha
  • Ficolin-A
  • M-ficolin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ficolin 1 (FCN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Ficolin 1 (FCN1) ELISA Kit

SEA786Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Ficolin 1 (FCN1) ELISA Kit

SEA786Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Ficolin 1 (FCN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Ficolin 1 (FCN1) in serum, plasma, tissue homogenates and other biological fluids.

FCN1 Rabbit Polyclonal Antibody