FN3K Rabbit Polyclonal Antibody
FN3K Polyclonal Antibody |
ABP58578-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210 |
FN3K Polyclonal Antibody |
ABP58578-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210 |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
DLR-FN3K-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Fructosamine-3-Kinase (FN3K) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Fructosamine-3-Kinase (FN3K) in samples from plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
DLR-FN3K-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Fructosamine-3-Kinase (FN3K) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Fructosamine-3-Kinase (FN3K) in samples from plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
RD-FN3K-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
RD-FN3K-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
RDR-FN3K-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Fructosamine-3-Kinase (FN3K) ELISA Kit |
RDR-FN3K-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
FN3K Rabbit pAb |
A13727-100ul |
Abclonal |
100 ul |
EUR 308 |
FN3K Rabbit pAb |
A13727-200ul |
Abclonal |
200 ul |
EUR 459 |
FN3K Rabbit pAb |
A13727-20ul |
Abclonal |
20 ul |
EUR 183 |
FN3K Rabbit pAb |
A13727-50ul |
Abclonal |
50 ul |
EUR 223 |
FN3K Antibody |
44782-100ul |
SAB |
100ul |
EUR 252 |
FN3K Antibody |
44782-50ul |
SAB |
50ul |
EUR 187 |
FN3K antibody |
70R-17336 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal FN3K antibody |
FN3K Antibody |
DF2468 |
Affbiotech |
200ul |
EUR 304 |
Description: FN3K antibody detects endogenous levels of total FN3K. |
FN3K Antibody |
1-CSB-PA008760GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against FN3K. Recognizes FN3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
FN3K Conjugated Antibody |
C44782 |
SAB |
100ul |
EUR 397 |
anti- FN3K antibody |
FNab03174 |
FN Test |
100µg |
EUR 585 |
- Immunogen: fructosamine 3 kinase
- Uniprot ID: Q9H479
- Gene ID: 64122
- Research Area: Metabolism
|
Description: Antibody raised against FN3K |
Anti-FN3K antibody |
STJ191809 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FN3K |
Anti-FN3K antibody |
STJ115680 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way, fructosamines, are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of fructosamines which may result in deglycation. |
FN3K siRNA |
20-abx917026 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FN3K siRNA |
20-abx917027 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-FN3K |
YF-PA20456 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to FN3K |
anti-FN3K |
YF-PA20457 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to FN3K |
anti-FN3K |
YF-PA20458 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to FN3K |
Human FN3K-RP Antibody |
33415-05111 |
AssayPro |
150 ug |
EUR 261 |
Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig) |
4-PAJ094Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FN3K (Met1~Lys309)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K) |
FN3K cloning plasmid |
CSB-CL872493HU-10ug |
Cusabio |
10ug |
EUR 370 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 930
- Sequence: atggagcagctgctgcgcgccgagctgcgcaccgcgaccctgcgggccttcggcggccccggcgccggctgcatcagcgagggccgagcctacgacacggacgcaggcccagtgttcgtcaaagtcaaccgcaggacgcaggcccggcagatgtttgagggggaggtggccagcct
- Show more
|
Description: A cloning plasmid for the FN3K gene. |
FN3K Blocking Peptide |
DF2468-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-FN3K (4F2) |
YF-MA19204 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FN3K |
Fructosamine-3-Kinase (FN3K) Antibody |
20-abx124749 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fructosamine-3-Kinase (FN3K) Antibody |
20-abx116834 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fructosamine-3-Kinase (FN3K) Antibody |
20-abx129034 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Fructosamine-3-Kinase (FN3K) Antibody |
abx122503-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Fructosamine-3-Kinase (FN3K) Antibody |
20-abx147674 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FN3K Rabbit Polyclonal Antibody