FN3K Rabbit Polyclonal Antibody

FN3K Rabbit Polyclonal Antibody

FN3K Polyclonal Antibody
ES10651-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FN3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

FN3K Polyclonal Antibody
ES10651-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FN3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Fructosamine-3-Kinase (FN3K) ELISA Kit
DLR-FN3K-Hu-48T	DL Develop	48T	EUR 517
Should the Human Fructosamine-3-Kinase (FN3K) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fructosamine-3-Kinase (FN3K) in samples from plasma, tissue homogenates, cell lysates or other biological fluids.

Human Fructosamine-3-Kinase (FN3K) ELISA Kit
DLR-FN3K-Hu-96T	DL Develop	96T	EUR 673
Should the Human Fructosamine-3-Kinase (FN3K) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fructosamine-3-Kinase (FN3K) in samples from plasma, tissue homogenates, cell lysates or other biological fluids.

Human Fructosamine-3-Kinase (FN3K) ELISA Kit
RDR-FN3K-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Fructosamine-3-Kinase (FN3K) ELISA Kit
RDR-FN3K-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Fructosamine-3-Kinase (FN3K) ELISA Kit
RD-FN3K-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Fructosamine-3-Kinase (FN3K) ELISA Kit
RD-FN3K-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

FN3K Rabbit pAb
A13727-100ul	Abclonal	100 ul	EUR 308

FN3K Rabbit pAb
A13727-200ul	Abclonal	200 ul	EUR 459

FN3K Rabbit pAb
A13727-20ul	Abclonal	20 ul	EUR 183

FN3K Rabbit pAb
A13727-50ul	Abclonal	50 ul	EUR 223

FN3K antibody
70R-17336	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FN3K antibody

FN3K Antibody
44782-100ul	SAB	100ul	EUR 252

FN3K Antibody
44782-50ul	SAB	50ul	EUR 187

FN3K Antibody
DF2468	Affbiotech	200ul	EUR 304
Description: FN3K antibody detects endogenous levels of total FN3K.

FN3K Antibody
1-CSB-PA008760GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FN3K. Recognizes FN3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FN3K Antibody
ABD2468	Lifescience Market	100 ug	EUR 438

FN3K Conjugated Antibody
C44782	SAB	100ul	EUR 397

anti- FN3K antibody
FNab03174	FN Test	100µg	EUR 585
Immunogen: fructosamine 3 kinase Uniprot ID: Q9H479 Gene ID: 64122 Research Area: Metabolism
Description: Antibody raised against FN3K

Anti-FN3K antibody
PAab03174	Lifescience Market	100 ug	EUR 412

Anti-FN3K antibody
STJ115680	St John's Laboratory	100 µl	EUR 277
Description: A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way, fructosamines, are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of fructosamines which may result in deglycation.

Anti-FN3K antibody
STJ191809	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to FN3K

FN3K siRNA
20-abx917026	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FN3K siRNA
20-abx917027	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-FN3K
YF-PA20456	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to FN3K

anti-FN3K
YF-PA20457	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to FN3K

anti-FN3K
YF-PA20458	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to FN3K

Human FN3K-RP Antibody
33415-05111	AssayPro	150 ug	EUR 261

Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig)
4-PAJ094Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FN3K (Met1~Lys309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K)

FN3K Blocking Peptide
DF2468-BP	Affbiotech	1mg	EUR 195

FN3K cloning plasmid
CSB-CL872493HU-10ug	Cusabio	10ug	EUR 370
Formulation: 10 μg plasmid + 200μl Glycerol Length: 930 Sequence: atggagcagctgctgcgcgccgagctgcgcaccgcgaccctgcgggccttcggcggccccggcgccggctgcatcagcgagggccgagcctacgacacggacgcaggcccagtgttcgtcaaagtcaaccgcaggacgcaggcccggcagatgtttgagggggaggtggccagcct Show more
Description: A cloning plasmid for the FN3K gene.

Anti-FN3K (4F2)
YF-MA19204	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FN3K

Fructosamine-3-Kinase (FN3K) Antibody
20-abx116834	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody
20-abx124749	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody
20-abx129034	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fructosamine-3-Kinase (FN3K) Antibody
abx122503-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody
20-abx147674	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody
20-abx172478	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Fructosamine-3-Kinase (FN3K) Antibody
abx034793-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody
abx233174-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), APC
4-PAJ094Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FN3K (Met1~Lys309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with APC.

Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAJ094Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FN3K (Met1~Lys309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with Biotin.

Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), Cy3
4-PAJ094Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FN3K (Met1~Lys309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with Cy3.

Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), FITC
4-PAJ094Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FN3K (Met1~Lys309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with FITC.

Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), HRP
4-PAJ094Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FN3K (Met1~Lys309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with HRP.

Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), PE
4-PAJ094Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FN3K (Met1~Lys309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with PE.

Human FN3K-RP Antibody (Biotin Conjugate)
33415-05121	AssayPro	150 ug	EUR 369

Fructosamine-3-Kinase (FN3K) Antibody (Biotin)
20-abx274324	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

FN3K protein (His tag)
30R-2948	Fitzgerald	50 ug	EUR 322
Description: Purified recombinant Human FN3K protein (His tag)

FN3K ELISA KIT|Human
EF009661	Lifescience Market	96 Tests	EUR 689

Mouse FN3K shRNA Plasmid
20-abx975229	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FN3K shRNA Plasmid
20-abx961933	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FN3K Recombinant Protein (Human)
RP012400	ABM	100 ug	Ask for price

FN3K Recombinant Protein (Rat)
RP201593	ABM	100 ug	Ask for price

FN3K Recombinant Protein (Mouse)
RP134894	ABM	100 ug	Ask for price

FN3K Recombinant Protein (Mouse)
RP134897	ABM	100 ug	Ask for price

Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAJ094Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FN3K (Met1~Lys309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K). This antibody is labeled with APC-Cy7.

Human FN3K-RP AssayLite Antibody (FITC Conjugate)
33415-05141	AssayPro	150 ug	EUR 428

Human FN3K-RP AssayLite Antibody (RPE Conjugate)
33415-05151	AssayPro	150 ug	EUR 428

Human FN3K-RP AssayLite Antibody (APC Conjugate)
33415-05161	AssayPro	150 ug	EUR 428

Human FN3K-RP AssayLite Antibody (PerCP Conjugate)
33415-05171	AssayPro	150 ug	EUR 471

Fn3k ORF Vector (Rat) (pORF)
ORF067199	ABM	1.0 ug DNA	EUR 506

FN3K ORF Vector (Human) (pORF)
ORF004134	ABM	1.0 ug DNA	EUR 95

Fn3k ORF Vector (Mouse) (pORF)
ORF044966	ABM	1.0 ug DNA	EUR 506

Fn3k ORF Vector (Mouse) (pORF)
ORF044967	ABM	1.0 ug DNA	EUR 506

Recombinant Fructosamine-3-Kinase (FN3K)
4-RPJ094Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9H479 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 38.9kDa Isoelectric Point: 7.1
Description: Recombinant Human Fructosamine-3-Kinase expressed in: E.coli

FN3K ELISA Kit (Human) (OKCD01046)
OKCD01046	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May initiate a process leading to the deglycation of fructoselysine and of glycated proteins. May play a role in the phosphorylation of 1-deoxy-1-morpholinofructose (DMF), fructoselysine, fructoseglycine, fructose and glycated lysozyme. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.114 ng/mL

FN3K ELISA Kit (Mouse) (OKCA01668)
OKCA01668	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: May initiate a process leading to the deglycation of fructoselysine and of glycated proteins. May play a role in the phosphorylation of 1-deoxy-1-morpholinofructose (DMF), fructoselysine, fructoseglycine, fructose and glycated lysozyme.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 15.6 pg/mL

FN3K ELISA Kit (Human) (OKDD00271)
OKDD00271	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way, fructosamines, are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of fructosamines which may result in deglycation.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.071 ng/mL

Monoclonal FN3K Antibody (N-term)(Ascites), Clone: 788CT24.5.1
AMM04559G	Leading Biology	0.1 ml	EUR 484
Description: A Monoclonal antibody against Human FN3K (N-term)(Ascites). The antibodies are raised in Mouse and are from clone 788CT24.5.1. This antibody is applicable in WB, E

Human Fructosamine-3-Kinase (FN3K) Protein
20-abx166574	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fn3k sgRNA CRISPR Lentivector set (Rat)
K6161201	ABM	3 x 1.0 ug	EUR 339

FN3K sgRNA CRISPR Lentivector set (Human)
K0791101	ABM	3 x 1.0 ug	EUR 339

Fn3k sgRNA CRISPR Lentivector set (Mouse)
K3534401	ABM	3 x 1.0 ug	EUR 339

Human Fructosamine 3 Kinase (FN3K) ELISA Kit
20-abx151588	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Fructosamine- 3- kinase, Fn3k ELISA KIT
ELI-07786m	Lifescience Market	96 Tests	EUR 865

Human Fructosamine-3-kinase(FN3K) ELISA kit
CSB-EL008760HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Fructosamine-3-kinase (FN3K) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Fructosamine-3-kinase(FN3K) ELISA kit
1-CSB-EL008760HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Fructosamine-3-kinase(FN3K) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Fructosamine 3 Kinase (FN3K) CLIA Kit
20-abx495614	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Fructosamine-3-Kinase (FN3K) ELISA Kit
abx389347-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Fructosamine- 3- kinase, FN3K ELISA KIT
ELI-47346h	Lifescience Market	96 Tests	EUR 824

Fn3k sgRNA CRISPR Lentivector (Rat) (Target 1)
K6161202	ABM	1.0 ug DNA	EUR 154

Fn3k sgRNA CRISPR Lentivector (Rat) (Target 2)
K6161203	ABM	1.0 ug DNA	EUR 154

Fn3k sgRNA CRISPR Lentivector (Rat) (Target 3)
K6161204	ABM	1.0 ug DNA	EUR 154

FN3K sgRNA CRISPR Lentivector (Human) (Target 1)
K0791102	ABM	1.0 ug DNA	EUR 154

FN3K sgRNA CRISPR Lentivector (Human) (Target 2)
K0791103	ABM	1.0 ug DNA	EUR 154

FN3K sgRNA CRISPR Lentivector (Human) (Target 3)
K0791104	ABM	1.0 ug DNA	EUR 154

Fn3k sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3534402	ABM	1.0 ug DNA	EUR 154

Fn3k sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3534403	ABM	1.0 ug DNA	EUR 154

Fn3k sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3534404	ABM	1.0 ug DNA	EUR 154

FN3K Fructosamine 3 Kinase Human Recombinant Protein
PROTQ9H479	BosterBio	Regular: 10ug	EUR 317
Description: FN3K Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 332 amino acids (1-309 a.a) and having a molecular mass of 37kDa.;FN3K is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

FN3K Protein Vector (Mouse) (pPB-C-His)
PV179862	ABM	500 ng	EUR 603

FN3K Protein Vector (Mouse) (pPB-N-His)
PV179863	ABM	500 ng	EUR 603

FN3K Protein Vector (Mouse) (pPM-C-HA)
PV179864	ABM	500 ng	EUR 603

FN3K Protein Vector (Mouse) (pPM-C-His)
PV179865	ABM	500 ng	EUR 603

FN3K Protein Vector (Mouse) (pPB-C-His)
PV179866	ABM	500 ng	EUR 603

FN3K Protein Vector (Mouse) (pPB-N-His)
PV179867	ABM	500 ng	EUR 603

FN3K Protein Vector (Mouse) (pPM-C-HA)
PV179868	ABM	500 ng	EUR 603

FN3K Protein Vector (Mouse) (pPM-C-His)
PV179869	ABM	500 ng	EUR 603

FN3K Protein Vector (Rat) (pPB-C-His)
PV268794	ABM	500 ng	EUR 603

FN3K Protein Vector (Rat) (pPB-N-His)
PV268795	ABM	500 ng	EUR 603

FN3K Protein Vector (Rat) (pPM-C-HA)
PV268796	ABM	500 ng	EUR 603

FN3K Protein Vector (Rat) (pPM-C-His)
PV268797	ABM	500 ng	EUR 603

FN3K Protein Vector (Human) (pPB-C-His)
PV016533	ABM	500 ng	EUR 329

FN3K Protein Vector (Human) (pPB-N-His)
PV016534	ABM	500 ng	EUR 329

FN3K Protein Vector (Human) (pPM-C-HA)
PV016535	ABM	500 ng	EUR 329

FN3K Protein Vector (Human) (pPM-C-His)
PV016536	ABM	500 ng	EUR 329

Human Fructosamine-3-Kinase(FN3K)ELISA Kit
QY-E03252	Qayee Biotechnology	96T	EUR 361

Recombinant Human FN3K Protein, His, E.coli-10ug
QP11893-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human FN3K Protein, His, E.coli-1mg
QP11893-1mg	EnQuireBio	1mg	EUR 5251

Recombinant Human FN3K Protein, His, E.coli-2ug
QP11893-2ug	EnQuireBio	2ug	EUR 155

Fn3k 3'UTR GFP Stable Cell Line
TU156645	ABM	1.0 ml	Ask for price

Fn3k 3'UTR Luciferase Stable Cell Line
TU106645	ABM	1.0 ml	Ask for price

Human Fructosamine-3-Kinase (FN3K) ELISA Kit
SEJ094Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fructosamine-3-Kinase (FN3K) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fructosamine-3-Kinase (FN3K) in plasma, tissue homogenates, cell lysates and other biological fluids.

Human Fructosamine-3-Kinase (FN3K) ELISA Kit
SEJ094Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fructosamine-3-Kinase (FN3K) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fructosamine-3-Kinase (FN3K) in plasma, tissue homogenates, cell lysates and other biological fluids.

Human Fructosamine-3-Kinase (FN3K) ELISA Kit
SEJ094Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fructosamine-3-Kinase (FN3K) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fructosamine-3-Kinase (FN3K) in plasma, tissue homogenates, cell lysates and other biological fluids.

Human Fructosamine-3-Kinase (FN3K) ELISA Kit
SEJ094Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fructosamine-3-Kinase (FN3K) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fructosamine-3-Kinase (FN3K) in plasma, tissue homogenates, cell lysates and other biological fluids.

Human Fructosamine-3-Kinase (FN3K) ELISA Kit
4-SEJ094Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Fructosamine-3-Kinase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fructosamine-3-Kinase (FN3K) in samples from plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Fn3k 3'UTR Luciferase Stable Cell Line
TU204706	ABM	1.0 ml	Ask for price

Fn3k 3'UTR GFP Stable Cell Line
TU254706	ABM	1.0 ml	Ask for price

FN3K 3'UTR GFP Stable Cell Line
TU058059	ABM	1.0 ml	EUR 1394

FN3K 3'UTR Luciferase Stable Cell Line
TU008059	ABM	1.0 ml	EUR 1394

ELISA kit for Human FN3K (Fructosamine-3-Kinase)
ELK4181	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fructosamine-3-Kinase (FN3K). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fruct Show more
Description: A sandwich ELISA kit for detection of Fructosamine-3-Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody
ABP57581-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG14L Rabbit Polyclonal Antibody
ABP57583-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

NBR1 Rabbit Polyclonal Antibody
ABP57585-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

WIPI2 Rabbit Polyclonal Antibody
ABP57587-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

WIPI2 Rabbit Polyclonal Antibody
ABP57587-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

WIPI2 Rabbit Polyclonal Antibody
ABP57587-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

FAK Rabbit Polyclonal Antibody
ABP57588-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

FAK Rabbit Polyclonal Antibody
ABP57588-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

FAK Rabbit Polyclonal Antibody
ABP57588-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

Gab1 Rabbit Polyclonal Antibody
ABP57589-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

Gab1 Rabbit Polyclonal Antibody
ABP57589-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

Gab1 Rabbit Polyclonal Antibody
ABP57589-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

ERK1 Rabbit Polyclonal Antibody
ABP57590-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

ERK1 Rabbit Polyclonal Antibody
ABP57590-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

ERK1 Rabbit Polyclonal Antibody
ABP57590-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IBA1 Polyclonal Rabbit Antibody
RA22133	Neuromics	100 ul	EUR 435

Fn3k ELISA Kit| Mouse Fructosamine-3-kinase ELISA Kit
EF014978	Lifescience Market	96 Tests	EUR 689

Rabbit polyclonal antibody for Shigella
704	Virostat	1 ml	EUR 321.88
Description: This is HRP conjugated rabbit polyclonal antibody against Shigella group for WB, ELISA.

5-hmC polyclonal antibody (rabbit)
6830-50	Biovision		EUR 316

Cyclooxygenase 1 Rabbit Polyclonal Antibody
38023-100ul	SAB	100ul	EUR 252

Cyclooxygenase 1 Rabbit Polyclonal Antibody
38023-50ul	SAB	50ul	EUR 187

Cyclooxygenase 2 Rabbit Polyclonal Antibody
38024-100ul	SAB	100ul	EUR 252

Cyclooxygenase 2 Rabbit Polyclonal Antibody
38024-50ul	SAB	50ul	EUR 187

Histone H3 Rabbit Polyclonal Antibody
38103-100ul	SAB	100ul	EUR 252

Histone H3 Rabbit Polyclonal Antibody
38103-50ul	SAB	50ul	EUR 187

Rabbit polyclonal METTL8(1) antibody
40013-100ul	SAB	100ul	EUR 390

Rabbit Anti-Clostridium Polyclonal Antibody
DPAB0230	Creative Diagnostics	1 ml	EUR 689

Rabbit Anti-Aspergillus Polyclonal Antibody
DPAB0232	Creative Diagnostics	1 ml	EUR 781

Rabbit Anti Aldosterone Polyclonal Antibody
DPBT-65724RA	Creative Diagnostics	1 ml	EUR 580

Rabbit Anti Cortisol Polyclonal Antibody
DPBT-65739RC	Creative Diagnostics	0.25 ml	EUR 663

Rabbit Anti Progesterone Polyclonal Antibody
DPBT-65781RP	Creative Diagnostics	0.2 ml	EUR 767

Rabbit Anti Progesterone Polyclonal Antibody
DPBT-65782RP	Creative Diagnostics	1 ml	EUR 580

Rabbit Anti Laminin Polyclonal Antibody
DPBT-66636RL	Creative Diagnostics	50 µl	EUR 429

Rabbit Anti Acetylcholine Polyclonal Antibody
DPBT-66692RA	Creative Diagnostics	1 ml	EUR 861

Rabbit Anti Serotonin Polyclonal Antibody
DPBT-66744RS	Creative Diagnostics	0.1 ml	EUR 1287

Rabbit Anti Serotonin Polyclonal Antibody
DPBT-66745RS	Creative Diagnostics	50 µl	EUR 580

Rabbit Anti Aspergillus Polyclonal Antibody
DPBT-66808RA	Creative Diagnostics	1 ml	EUR 767

Rabbit Anti Tubulin Polyclonal Antibody
DPBT-67229RT	Creative Diagnostics	0.5 ml	EUR 663

Rabbit Anti Morf4 Polyclonal Antibody
DPBT-67360RM	Creative Diagnostics	50 µg	EUR 533

Rabbit Anti Morf4 Polyclonal Antibody
DPBT-67361RM	Creative Diagnostics	0.1 mg	EUR 663

Rabbit Anti Fitc Polyclonal Antibody
DPBT-68178RF	Creative Diagnostics	1 mg	EUR 944

Rabbit Anti Hexokinase Polyclonal Antibody
DPBT-68187RH	Creative Diagnostics	1 ml	EUR 819

Rabbit Anti Fitc Polyclonal Antibody
DPBT-68210RF	Creative Diagnostics	1 ml	EUR 580

Rabbit Anti Phosphoserine Polyclonal Antibody
DPBT-68211RP	Creative Diagnostics	50 µg	EUR 1089

Rabbit Anti Phosphoserine Polyclonal Antibody
DPBT-68214RP	Creative Diagnostics	50 µg	EUR 892

Rabbit Anti Phosphothreonine Polyclonal Antibody
DPBT-68217RP	Creative Diagnostics	50 µg	EUR 710

Rabbit Anti Phenobarbital Polyclonal Antibody
DPBT-68286RP	Creative Diagnostics	1 ml	EUR 663

Rabbit Anti Theophylline Polyclonal Antibody
DPBT-68291RT	Creative Diagnostics	1 ml	EUR 663

Rabbit Anti Vancomycin Polyclonal Antibody
DPBT-68294RV	Creative Diagnostics	1 ml	EUR 580

Polyclonal Rabbit Anti-AXL antibody
APR05486G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rabbit Anti-AXL . This antibody is tested and proven to work in the following applications:

Polyclonal Rabbit Anti-DHCR7 antibody
AMR09690G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rabbit Anti-DHCR7 . This antibody is tested and proven to work in the following applications:

Polyclonal Rabbit Anti-IFNGR2 antibody
AMR09691G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rabbit Anti-IFNGR2 . This antibody is tested and proven to work in the following applications:

Polyclonal Rabbit Anti-STRA6 antibody
AMR09692G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rabbit Anti-STRA6 . This antibody is tested and proven to work in the following applications:

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Rabbit Anti-C1q Polyclonal Antibody
CTA-356-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-C1q polyclonal antibodyfor WB.

Rabbit Anti-C1q Polyclonal Antibody
CTA-356-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-C1q polyclonal antibodyfor WB.

Rabbit Anti-C1QL1 Polyclonal Antibody
CTA-368-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit mouse anti-C1QL1 polyclonal antibodyfor WB.

Rabbit Anti-C1QL1 Polyclonal Antibody
CTA-368-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit mouse anti-C1QL1 polyclonal antibodyfor WB.

Rabbit Anti-C1QB Polyclonal Antibody
CTA-389-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-C1QB polyclonal antibodyfor WB.

Rabbit Anti-C1QB Polyclonal Antibody
CTA-389-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-C1QB polyclonal antibodyfor WB.

Rabbit Anti-Properdin Polyclonal Antibody
CTA-394-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-Properdin polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-Properdin Polyclonal Antibody
CTA-394-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-Properdin polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-C8B Polyclonal Antibody
CTA-425-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-C8B polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-C8B Polyclonal Antibody
CTA-425-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-C8B polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-C8G Polyclonal Antibody
CTA-426-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-C8G polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-C8G Polyclonal Antibody
CTA-426-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-C8G polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-Vitronectin Polyclonal Antibody
CTA-430-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-Vitronectin polyclonal antibodyfor ICC/IF, IHC, IHC-P.

Rabbit Anti-Vitronectin Polyclonal Antibody
CTA-430-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-Vitronectin polyclonal antibodyfor ICC/IF, IHC, IHC-P.

Rabbit Anti-CTRP2 Polyclonal Antibody
CTA-437-100ug	Creative Biolabs	100ug	Ask for price
Description: Mouse anti-CTRP2 polyclonal antibody for ICC/IF, IHC, IHC-P.

Rabbit Anti-CTRP2 Polyclonal Antibody
CTA-437-1mg	Creative Biolabs	1mg	Ask for price
Description: Mouse anti-CTRP2 polyclonal antibody for ICC/IF, IHC, IHC-P.

Rabbit Anti-CTRP6 Polyclonal Antibody
CTA-442-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-CTRP6 polyclonal antibody for WB, ELISA, ICC/IF, IHC, IHC-P.

Rabbit Anti-CTRP6 Polyclonal Antibody
CTA-442-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-CTRP6 polyclonal antibody for WB, ELISA, ICC/IF, IHC, IHC-P.

Rabbit Anti-CTRP7 Polyclonal Antibody
CTA-449-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-CTRP7 polyclonal antibody for WB, ELISA, ICC/IF, IHC, IHC-P.

Rabbit Anti-CTRP7 Polyclonal Antibody
CTA-449-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-CTRP7 polyclonal antibody for WB, ELISA, ICC/IF, IHC, IHC-P.

Rabbit Anti-CD11c Polyclonal Antibody
CTA-474-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-CD11c polyclonal antibodyfor IHC-P.

Rabbit Anti-CD11c Polyclonal Antibody
CTA-474-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-CD11c polyclonal antibodyfor IHC-P.

Rabbit Anti-CD21 Polyclonal Antibody
CTA-477-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-CD21 polyclonal antibodyfor IHC, IHC-P.

Rabbit Anti-CD21 Polyclonal Antibody
CTA-477-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-CD21 polyclonal antibodyfor IHC, IHC-P.

Rabbit Anti-CD35 Polyclonal Antibody
CTA-480-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-CD35 polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-CD35 Polyclonal Antibody
CTA-480-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-CD35 polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-SHMT2 Polyclonal Antibody
CTA-491-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-SHMT2 polyclonal antibodyfor WB, ICC/IF, IHC, IHC-P.

Rabbit Anti-SHMT2 Polyclonal Antibody
CTA-491-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-SHMT2 polyclonal antibodyfor WB, ICC/IF, IHC, IHC-P.

Rabbit Anti-RGC32 Polyclonal Antibody
CTA-494-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-RGC32 polyclonal antibodyfor ICC/IF.

Rabbit Anti-RGC32 Polyclonal Antibody
CTA-494-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-RGC32 polyclonal antibodyfor ICC/IF.

Rabbit Anti-DHODH Polyclonal Antibody
CTA-501-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-DHODH polyclonal antibodyfor WB.

Rabbit Anti-DHODH Polyclonal Antibody
CTA-501-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-DHODH polyclonal antibodyfor WB.

Rabbit Anti-CD46 Polyclonal Antibody
CTA-513-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-CD46 polyclonal antibodyfor IHC, IHC-P.

Rabbit Anti-CD46 Polyclonal Antibody
CTA-513-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-CD46 polyclonal antibodyfor IHC, IHC-P.

Rabbit Anti-CD59 Polyclonal Antibody
CTA-521-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbt anti-CD59 polyclonal antibodyfor ELISA.

Rabbit Anti-CD59 Polyclonal Antibody
CTA-521-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbt anti-CD59 polyclonal antibodyfor ELISA.

beta Actin Rabbit Polyclonal Antibody
A01011-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:3000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of beta Actin from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This beta Actin antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

beta Actin Rabbit Polyclonal Antibody
A01011-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:3000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of beta Actin from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This beta Actin antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

beta Actin Rabbit Polyclonal Antibody
A01011-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:3000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of beta Actin from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This beta Actin antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

DDDDK Tag Rabbit Polyclonal Antibody
A02011-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DDDDK Tag from Null. This DDDDK Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DDDDK Tag Rabbit Polyclonal Antibody
A02011-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DDDDK Tag from Null. This DDDDK Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DDDDK Tag Rabbit Polyclonal Antibody
A02011-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DDDDK Tag from Null. This DDDDK Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DDDDK Tag Rabbit Polyclonal Antibody
A02011HRP-005ml	Abbkine	0.05ml	EUR 180
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DDDDK Tag from Null. This DDDDK Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DDDDK Tag Rabbit Polyclonal Antibody
A02011HRP-02ml	Abbkine	0.2ml	EUR 398
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DDDDK Tag from Null. This DDDDK Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DDDDK Tag Rabbit Polyclonal Antibody
A02011HRP-02ml5	Abbkine	0.2ml×5	EUR 1265
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of DDDDK Tag from Null. This DDDDK Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in rabbit by using as an immunogen synthetic peptide

GFP Tag Rabbit Polyclonal Antibody
A02021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of GFP Tag from Null. This GFP Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GFP Tag Rabbit Polyclonal Antibody
A02021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of GFP Tag from Null. This GFP Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GFP Tag Rabbit Polyclonal Antibody
A02021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of GFP Tag from Null. This GFP Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GFP Tag Rabbit Polyclonal Antibody
A02021HRP-005ml	Abbkine	0.05ml	EUR 180
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of GFP Tag from Null. This GFP Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in rabbit by using as an immunogen recombinant protein

GFP Tag Rabbit Polyclonal Antibody
A02021HRP-02ml	Abbkine	0.2ml	EUR 398
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of GFP Tag from Null. This GFP Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in rabbit by using as an immunogen recombinant protein

GFP Tag Rabbit Polyclonal Antibody
A02021HRP-02ml5	Abbkine	0.2ml×5	EUR 1265
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of GFP Tag from Null. This GFP Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in rabbit by using as an immunogen recombinant protein

HA Tag Rabbit Polyclonal Antibody
A02041-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of HA Tag from Null. This HA Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

HA Tag Rabbit Polyclonal Antibody
A02041-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclona