FN3K Rabbit Polyclonal Antibody

FN3K Rabbit Polyclonal Antibody

FN3K Polyclonal Antibody

ABP58578-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210

FN3K Polyclonal Antibody

ABP58578-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210

Human Fructosamine-3-Kinase (FN3K) ELISA Kit

DLR-FN3K-Hu-48T 48T
EUR 517
  • Should the Human Fructosamine-3-Kinase (FN3K) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fructosamine-3-Kinase (FN3K) in samples from plasma, tissue homogenates, cell lysates or other biological fluids.

Human Fructosamine-3-Kinase (FN3K) ELISA Kit

DLR-FN3K-Hu-96T 96T
EUR 673
  • Should the Human Fructosamine-3-Kinase (FN3K) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fructosamine-3-Kinase (FN3K) in samples from plasma, tissue homogenates, cell lysates or other biological fluids.

Human Fructosamine-3-Kinase (FN3K) ELISA Kit

RD-FN3K-Hu-48Tests 48 Tests
EUR 521

Human Fructosamine-3-Kinase (FN3K) ELISA Kit

RD-FN3K-Hu-96Tests 96 Tests
EUR 723

Human Fructosamine-3-Kinase (FN3K) ELISA Kit

RDR-FN3K-Hu-48Tests 48 Tests
EUR 544

Human Fructosamine-3-Kinase (FN3K) ELISA Kit

RDR-FN3K-Hu-96Tests 96 Tests
EUR 756

FN3K Rabbit pAb

A13727-100ul 100 ul
EUR 308

FN3K Rabbit pAb

A13727-200ul 200 ul
EUR 459

FN3K Rabbit pAb

A13727-20ul 20 ul
EUR 183

FN3K Rabbit pAb

A13727-50ul 50 ul
EUR 223

FN3K Antibody

ABD2468 100 ug
EUR 438

FN3K Antibody

44782-100ul 100ul
EUR 252

FN3K Antibody

44782-50ul 50ul
EUR 187

FN3K antibody

70R-17336 50 ul
EUR 435
Description: Rabbit polyclonal FN3K antibody

FN3K Antibody

DF2468 200ul
EUR 304
Description: FN3K antibody detects endogenous levels of total FN3K.

FN3K Antibody

1-CSB-PA008760GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FN3K. Recognizes FN3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FN3K Conjugated Antibody

C44782 100ul
EUR 397

anti- FN3K antibody

FNab03174 100µg
EUR 585
  • Immunogen: fructosamine 3 kinase
  • Uniprot ID: Q9H479
  • Gene ID: 64122
  • Research Area: Metabolism
Description: Antibody raised against FN3K

Anti-FN3K antibody

PAab03174 100 ug
EUR 412

Anti-FN3K antibody

STJ191809 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FN3K

Anti-FN3K antibody

STJ115680 100 µl
EUR 277
Description: A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way, fructosamines, are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of fructosamines which may result in deglycation.

FN3K siRNA

20-abx917026
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FN3K siRNA

20-abx917027
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-FN3K

YF-PA20456 50 ul
EUR 363
Description: Mouse polyclonal to FN3K

anti-FN3K

YF-PA20457 100 ul
EUR 403
Description: Rabbit polyclonal to FN3K

anti-FN3K

YF-PA20458 100 ug
EUR 403
Description: Rabbit polyclonal to FN3K

Human FN3K-RP Antibody

33415-05111 150 ug
EUR 261

Fructosamine-3-Kinase (FN3K) Polyclonal Antibody (Human, Pig)

4-PAJ094Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FN3K (Met1~Lys309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Fructosamine-3-Kinase (FN3K)

FN3K cloning plasmid

CSB-CL872493HU-10ug 10ug
EUR 370
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 930
  • Sequence: atggagcagctgctgcgcgccgagctgcgcaccgcgaccctgcgggccttcggcggccccggcgccggctgcatcagcgagggccgagcctacgacacggacgcaggcccagtgttcgtcaaagtcaaccgcaggacgcaggcccggcagatgtttgagggggaggtggccagcct
  • Show more
Description: A cloning plasmid for the FN3K gene.

FN3K Blocking Peptide

DF2468-BP 1mg
EUR 195

Anti-FN3K (4F2)

YF-MA19204 100 ug
EUR 363
Description: Mouse monoclonal to FN3K

Fructosamine-3-Kinase (FN3K) Antibody

20-abx124749
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody

20-abx116834
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody

20-abx129034
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fructosamine-3-Kinase (FN3K) Antibody

abx122503-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody

20-abx147674
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

FN3K Rabbit Polyclonal Antibody