HSPB3 Rabbit Polyclonal Antibody

HSPB3 Rabbit Polyclonal Antibody

Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit

DLR-HSPb3-Hu-48T 48T
EUR 517
  • Should the Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heat Shock Protein Beta 3 (HSPb3) in samples from tissue homogenates or other biological fluids.

Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit

DLR-HSPb3-Hu-96T 96T
EUR 673
  • Should the Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heat Shock Protein Beta 3 (HSPb3) in samples from tissue homogenates or other biological fluids.

Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit

RDR-HSPb3-Hu-48Tests 48 Tests
EUR 544

Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit

RDR-HSPb3-Hu-96Tests 96 Tests
EUR 756

Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit

RD-HSPb3-Hu-48Tests 48 Tests
EUR 521

Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit

RD-HSPb3-Hu-96Tests 96 Tests
EUR 723

HSPB3 Antibody

44808-100ul 100ul
EUR 252

HSPB3 Antibody

44808-50ul 50ul
EUR 187

HSPB3 Antibody

DF2505 200ul
EUR 304
Description: HSPB3 antibody detects endogenous levels of total HSPB3.

HSPB3 Antibody

ABD2505 100 ug
EUR 438

Hspb3/ Rat Hspb3 ELISA Kit

ELI-30987r 96 Tests
EUR 886

HSPB3 Conjugated Antibody

C44808 100ul
EUR 397

Anti-HSPB3 antibody

STJ191855 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HSPB3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HSPB3 Blocking Peptide

DF2505-BP 1mg
EUR 195

HSPB3 cloning plasmid

CSB-CL614265HU-10ug 10ug
EUR 237
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 453
  • Sequence: atggcaaaaatcattttgaggcacctcatagagattccagtgcgttaccaggaagagtttgaagctcgaggtctagaagactgcaggctggatcatgctttatatgcactgcctgggccaaccatcgtggacctgaggaaaaccagggcagcgcagtctcctccagtggactcagc
  • Show more
Description: A cloning plasmid for the HSPB3 gene.

Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3)

HSPB3 protein (His tag)

80R-1958 100 ug
EUR 322
Description: Recombinant human HSPB3 protein

Mouse HSPB3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat HSPB3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HSPB3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HSPB3 Recombinant Protein (Human)

RP039934 100 ug Ask for price

HSPB3 Recombinant Protein (Rat)

RP205265 100 ug Ask for price

HSPB3 Recombinant Protein (Mouse)

RP142646 100 ug Ask for price

Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with APC.

Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with Biotin.

Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with Cy3.

Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with FITC.

Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with HRP.

Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with PE.

Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with APC-Cy7.

Heat Shock Protein Beta 3 (HSPb3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Heat Shock Protein Beta 3 (HSPB3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Heat Shock Protein Beta 3 (HSPb3) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hspb3 ORF Vector (Rat) (pORF)

ORF068423 1.0 ug DNA
EUR 506

HSPB3 ORF Vector (Human) (pORF)

ORF013312 1.0 ug DNA
EUR 354

Hspb3 ORF Vector (Mouse) (pORF)

ORF047550 1.0 ug DNA
EUR 506

HSPB3 ELISA Kit (Human) (OKCD01255)

OKCD01255 96 Wells
EUR 831
Description: Description of target: Inhibitor of actin polymerization. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.29 ng/mL

Human Heat Shock Protein beta-3 (HSPB3) Antibody

32275-05111 150 ug
EUR 261

Hspb3 sgRNA CRISPR Lentivector set (Rat)

K6939101 3 x 1.0 ug
EUR 339

Hspb3 sgRNA CRISPR Lentivector set (Mouse)

K3493101 3 x 1.0 ug
EUR 339

HSPB3 sgRNA CRISPR Lentivector set (Human)

K0999401 3 x 1.0 ug
EUR 339

Hspb3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6939102 1.0 ug DNA
EUR 154

Hspb3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6939103 1.0 ug DNA
EUR 154

Hspb3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6939104 1.0 ug DNA
EUR 154

Hspb3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3493102 1.0 ug DNA
EUR 154

Hspb3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3493103 1.0 ug DNA
EUR 154

Hspb3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3493104 1.0 ug DNA
EUR 154

HSPB3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0999402 1.0 ug DNA
EUR 154

HSPB3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0999403 1.0 ug DNA
EUR 154

HSPB3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0999404 1.0 ug DNA
EUR 154

HSPB3 Protein Vector (Rat) (pPB-C-His)

PV273690 500 ng
EUR 603

HSPB3 Protein Vector (Rat) (pPB-N-His)

PV273691 500 ng
EUR 603

HSPB3 Protein Vector (Rat) (pPM-C-HA)

PV273692 500 ng
EUR 603

HSPB3 Protein Vector (Rat) (pPM-C-His)

PV273693 500 ng
EUR 603

HSPB3 Protein Vector (Mouse) (pPB-C-His)

PV190198 500 ng
EUR 603

HSPB3 Protein Vector (Mouse) (pPB-N-His)

PV190199 500 ng
EUR 603

HSPB3 Protein Vector (Mouse) (pPM-C-HA)

PV190200 500 ng
EUR 603

HSPB3 Protein Vector (Mouse) (pPM-C-His)

PV190201 500 ng
EUR 603

HSPB3 Protein Vector (Human) (pPB-C-His)

PV053245 500 ng
EUR 481

HSPB3 Protein Vector (Human) (pPB-N-His)

PV053246 500 ng
EUR 481

HSPB3 Protein Vector (Human) (pPM-C-HA)

PV053247 500 ng
EUR 481

HSPB3 Protein Vector (Human) (pPM-C-His)

PV053248 500 ng
EUR 481

Recombinant Heat Shock Protein Beta 3 (HSPb3)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q12988
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Heat Shock Protein Beta 3 expressed in: E.coli

Recombinant Human HSPB3 Protein, His, E.coli-1mg

QP12332-1mg 1mg
EUR 2757

Recombinant Human HSPB3 Protein, His, E.coli-20ug

QP12332-20ug 20ug
EUR 201

Recombinant Human HSPB3 Protein, His, E.coli-5ug

QP12332-5ug 5ug
EUR 155

Hspb3 3'UTR Luciferase Stable Cell Line

TU109807 1.0 ml Ask for price

Hspb3 3'UTR Luciferase Stable Cell Line

TU206018 1.0 ml Ask for price

Hspb3 3'UTR GFP Stable Cell Line

TU159807 1.0 ml Ask for price

Hspb3 3'UTR GFP Stable Cell Line

TU256018 1.0 ml Ask for price

HSPB3 3'UTR GFP Stable Cell Line

TU060267 1.0 ml
EUR 1394

HSPB3 3'UTR Luciferase Stable Cell Line

TU010267 1.0 ml
EUR 1394

Human Heat Shock Protein beta-3 (HSPB3) Antibody (Biotin Conjugate)

32275-05121 150 ug
EUR 369

Human Heat Shock Protein Beta 3 (HSPb3) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

HSPB3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV652093 1.0 ug DNA
EUR 514

HSPB3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV652097 1.0 ug DNA
EUR 514

HSPB3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV652098 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

HSPB3 Rabbit Polyclonal Antibody