IDS Rabbit Polyclonal Antibody

IDS Rabbit Polyclonal Antibody

IDS Polyclonal Antibody

ES10912-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IDS from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

IDS Polyclonal Antibody

ES10912-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IDS from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

DLR-IDS-Hu-48T 48T
EUR 517
  • Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

DLR-IDS-Hu-96T 96T
EUR 673
  • Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RDR-IDS-Hu-48Tests 48 Tests
EUR 544

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RDR-IDS-Hu-96Tests 96 Tests
EUR 756

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RD-IDS-Hu-48Tests 48 Tests
EUR 521

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RD-IDS-Hu-96Tests 96 Tests
EUR 723

IDS Rabbit pAb

A1857-100ul 100 ul
EUR 308

IDS Rabbit pAb

A1857-200ul 200 ul
EUR 459

IDS Rabbit pAb

A1857-20ul 20 ul
EUR 183

IDS Rabbit pAb

A1857-50ul 50 ul
EUR 223

Polyclonal IDS Antibody (Internal)

APG01181G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IDS (Internal). This antibody is tested and proven to work in the following applications:

IDS Polyclonal Conjugated Antibody

C31899 100ul
EUR 397

IDS Polyclonal Conjugated Antibody

C30396 100ul
EUR 397

IDS antibody

70R-10208 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal IDS antibody

IDS antibody

31899-100ul 100ul
EUR 252

IDS antibody

31899-50ul 50ul
EUR 187

IDS antibody

10R-6986 100 ul
EUR 691
Description: Mouse monoclonal IDS antibody

IDS antibody

10R-6987 100 ul
EUR 691
Description: Mouse monoclonal IDS antibody

IDS antibody

10R-6988 100 ul
EUR 726
Description: Mouse monoclonal IDS antibody

Rabbit IDS ELISA Kit

ERTI0341 96Tests
EUR 521

Polyclonal Goat Anti-IDS Antibody

APG00165G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-IDS . This antibody is tested and proven to work in the following applications:

Anti-IDS antibody

STJ24123 100 µl
EUR 277
Description: This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed.

Anti-IDS antibody

STJ71754 100 µg
EUR 359

Anti-IDS antibody

STJ192070 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IDS

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS)

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Arg95~Pro289)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS)

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Biotin.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Cy3.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with FITC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with HRP.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with PE.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with Biotin.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with Cy3.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with FITC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with HRP.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with PE.

IDS Blocking Peptide

33R-8437 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IDS antibody, catalog no. 70R-10208

IDS cloning plasmid

CSB-CL010998HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 939
  • Sequence: atgccgccaccccggaccggccgaggccttctctggctgggtctggttctgagctccgtctgcgtcgccctcggatccgaaacgcaggccaactcgaccacagatgctctgaacgttcttctcatcatcgtggatgacctgcgcccctccctgggctgttatggggataagctggt
  • Show more
Description: A cloning plasmid for the IDS gene.

Iduronate 2-Sulfatase (IDS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Antibody

  • EUR 314.00
  • EUR 133.00
  • EUR 815.00
  • EUR 425.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Iduronate-2-Sulfatase (IDS) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Iduronate-2-Sulfatase (IDS) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Iduronate 2-Sulfatase (IDS) Antibody

abx145606-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Iduronate 2-Sulfatase (IDS) Antibody

abx432837-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Arg95~Pro289)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Arg95~Pro289)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Biotin.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Arg95~Pro289)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Cy3.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Arg95~Pro289)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with FITC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Arg95~Pro289)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with HRP.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Arg95~Pro289)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with PE.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Leu180~Asp448)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC-Cy7.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Ile107~Thr363)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC-Cy7.

Anti-Iduronate 2 sulfatase/IDS Antibody

PA1917 100ug/vial
EUR 334

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IDS (Arg95~Pro289)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC-Cy7.


ELA-E0204h 96 Tests
EUR 824


EHI0341 96Tests
EUR 521

Bovine IDS ELISA Kit

EBI0341 96Tests
EUR 521

Canine IDS ELISA Kit

ECI0341 96Tests
EUR 521

Anserini IDS ELISA Kit

EAI0341 96Tests
EUR 521


EGTI0341 96Tests
EUR 521


EF006009 96 Tests
EUR 689

Human IDS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse IDS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine IDS ELISA Kit

EPI0341 96Tests
EUR 521


ERI0341 96Tests
EUR 521


EMI0341 96Tests
EUR 521

IDS Recombinant Protein (Human)

RP015568 100 ug Ask for price

IDS Recombinant Protein (Mouse)

RP142919 100 ug Ask for price

Monoclonal IDS Antibody (clone 3B10), Clone: 3B10

AMM02257G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human IDS (clone 3B10). The antibodies are raised in Mouse and are from clone 3B10. This antibody is applicable in WB and IHC-P, IF, Flo

Monoclonal IDS Antibody (clone 3B4), Clone: 3B4

AMM02300G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human IDS (clone 3B4). The antibodies are raised in Mouse and are from clone 3B4. This antibody is applicable in WB and IHC-P, E

ELISA kit for Human IDS

EK5680 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human IDS in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse IDS

EK5681 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse IDS in samples from serum, plasma, tissue homogenates and other biological fluids.

Human IDS PicoKine ELISA Kit

EK1452 96 wells
EUR 425
Description: For quantitative detection of human IDS in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse IDS PicoKine ELISA Kit

EK1453 96 wells
EUR 425
Description: For quantitative detection of mouse IDS in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Guinea Pig IDS ELISA Kit

EGI0341 96Tests
EUR 521

IDS ORF Vector (Human) (pORF)

ORF005190 1.0 ug DNA
EUR 95

Ids ORF Vector (Mouse) (pORF)

ORF047641 1.0 ug DNA
EUR 506

Recombinant Iduronate-2-Sulfatase (IDS)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22304
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Iduronate-2-Sulfatase expressed in: E.coli

Recombinant Iduronate-2-Sulfatase (IDS)

  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q08890
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Iduronate-2-Sulfatase expressed in: E.coli

Recombinant Iduronate-2-Sulfatase (IDS)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: F1LLW8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 59.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Iduronate-2-Sulfatase expressed in: E.coli

pECMV-Ids-m-FLAG Plasmid

PVT15700 2 ug
EUR 325

IDS ELISA Kit (Human) (OKAN05423)

OKAN05423 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

IDS ELISA Kit (Human) (OKBB01001)

OKBB01001 96 Wells
EUR 505
Description: Description of target: Iduronate 2-sulfatase (IDS) is a sulfatase enzyme associated with Hunter syndrome. It encodes a member of the sulfatase family of proteins. Iduronate 2-sulfatase is involved in the lysosomal degradation of the glycosaminoglycans heparan sulfate and dermatan sulfate. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <15pg/ml

IDS ELISA Kit (Mouse) (OKBB01002)

OKBB01002 96 Wells
EUR 505
Description: Description of target: Iduronate 2-sulfatase (IDS) is a sulfatase enzyme associated with Hunter syndrome. It encodes a member of the sulfatase family of proteins. Iduronate 2-sulfatase is involved in the lysosomal degradation of the glycosaminoglycans heparan sulfate and dermatan sulfate. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <15pg/ml

IDS ELISA Kit (Human) (OKCD09108)

OKCD09108 96 Wells
EUR 975
Description: Description of target: Iduronate-2-sulfatase is required for the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this X-chromosome gene that result in enzymatic deficiency lead to the sex-linked Mucopolysaccharidosis Type II, also known as Hunter Syndrome. Iduronate-2-sulfatase has a strong sequence similarity with human arylsulfatases A, B, and C, and human glucosamine-6-sulfatase. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

IDS ELISA Kit (Mouse) (OKEH05904)

OKEH05904 96 Wells
EUR 662
Description: Description of target: Required for the lysosomal degradation of heparan sulfate and dermatan sulfate.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL

IDS ELISA Kit (Rat) (OKEI00788)

OKEI00788 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL

Human iduronate sulfatase,IDS ELISA Kit

201-12-0731 96 tests
EUR 440
  • This iduronate sulfatase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Rat Iduronate-2-Sulfatase (IDS) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Iduronate-2-Sulfatase (IDS) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Iduronate-2-Sulfatase (IDS) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat iduronate sulfatase,IDS ELISA Kit

CN-02004R1 96T
EUR 468

Rat iduronate sulfatase,IDS ELISA Kit

CN-02004R2 48T
EUR 318

Human iduronate sulfatase,IDS ELISA Kit

CN-04541H1 96T
EUR 448

Human iduronate sulfatase,IDS ELISA Kit

CN-04541H2 48T
EUR 297

Human iduronate sulfatase, IDS ELISA Kit

CSB-E09471h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human iduronate sulfatase, IDS ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Iduronate Sulfatase (IDS) ELISA Kit

abx570921-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human iduronate sulfatase(IDS)ELISA Kit

GA-E0747HM-48T 48T
EUR 289

Human iduronate sulfatase(IDS)ELISA Kit

GA-E0747HM-96T 96T
EUR 466

Rat iduronate sulfatase(IDS)ELISA Kit

GA-E0115RT-48T 48T
EUR 317

Rat iduronate sulfatase(IDS)ELISA Kit

GA-E0115RT-96T 96T
EUR 496

Ids sgRNA CRISPR Lentivector set (Mouse)

K3827101 3 x 1.0 ug
EUR 339

IDS sgRNA CRISPR Lentivector set (Human)

K1015501 3 x 1.0 ug
EUR 339

Human iduronate sulfatase(IDS)ELISA Kit

QY-E04351 96T
EUR 361

Rat iduronate sulfatase(IDS)ELISA Kit

QY-E11538 96T
EUR 361

Mouse iduronate sulfatase(IDS)ELISA Kit

QY-E20773 96T
EUR 361

ELISA kit for Rat IDS (Iduronate Sulfatase)

E-EL-R0514 1 plate of 96 wells
EUR 534
  • Gentaur's IDS ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat IDS. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat IDS (Iduronate Sulfatase) in samples from Serum, Plasma, Cell supernatant

Human Iduronate-2-Sulfatase (IDS) CLIA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Iduronate 2-Sulfatase (IDS) ELISA Kit

abx253725-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human IDS/ Iduronate 2-sulfatase ELISA Kit

E1209Hu 1 Kit
EUR 571

Human IDS(Iduronate 2-sulfatase) ELISA Kit

EH0767 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P22304
  • Alias: IDS/SIDS/MPS2/S/Alpha-L-iduronate sulfate sulfatase/iduronate 2-sulfatase/iduronate 2-sulfatase 14 kDa chain/iduronate 2-sulfatase 42 kDa chain/idursulfase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse Iduronate 2-Sulfatase (Ids) ELISA Kit

abx512185-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Ids sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3827102 1.0 ug DNA
EUR 154

Ids sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3827103 1.0 ug DNA
EUR 154

Ids sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3827104 1.0 ug DNA
EUR 154

IDS sgRNA CRISPR Lentivector (Human) (Target 1)

K1015502 1.0 ug DNA
EUR 154

IDS sgRNA CRISPR Lentivector (Human) (Target 2)

K1015503 1.0 ug DNA
EUR 154

IDS sgRNA CRISPR Lentivector (Human) (Target 3)

K1015504 1.0 ug DNA
EUR 154

IDS Iduronate 2-Sulfatase Human Recombinant Protein

PROTP22304 Regular: 10ug
EUR 317
Description: IDS Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 533 amino acids (26-550a.a) and having a molecular mass of 60.3kDa. (Molecular size on SDS-PAGE will appear at approximately 35-70kDa). IDS is fused to an 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

IDS Protein Vector (Human) (pPB-C-His)

PV020757 500 ng
EUR 329

IDS Protein Vector (Human) (pPB-N-His)

PV020758 500 ng
EUR 329

IDS Protein Vector (Human) (pPM-C-HA)

PV020759 500 ng
EUR 329

IDS Protein Vector (Human) (pPM-C-His)

PV020760 500 ng
EUR 329

IDS Protein Vector (Mouse) (pPB-C-His)

PV190562 500 ng
EUR 603

IDS Protein Vector (Mouse) (pPB-N-His)

PV190563 500 ng
EUR 603

IDS Protein Vector (Mouse) (pPM-C-HA)

PV190564 500 ng
EUR 603

IDS Protein Vector (Mouse) (pPM-C-His)

PV190565 500 ng
EUR 603

Human Iduronate-2-Sulfatase ELISA Kit (IDS)

RK01625 96 Tests
EUR 521

Human Iduronate-2-Sulfatase (IDS)CLIA Kit

SCH833Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit

SCH833Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit

SCH833Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit

SCH833Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) CLIA Kit

  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Iduronate-2-Sulfatase Clia kit. Alternative names of the recognized antigen: MPS2
  • SIDS
  • Hunter Syndrome
  • Idursulfase
  • Alpha-L-iduronate sulfate sulfatase
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS)Tissue homogenates and other biological fluids

Recombinant Human IDS Protein, His, Insect-10ug

QP12369-10ug 10ug
EUR 201

Recombinant Human IDS Protein, His, Insect-1mg

QP12369-1mg 1mg
EUR 5251

Recombinant Human IDS Protein, His, Insect-2ug

QP12369-2ug 2ug
EUR 155

Ids 3'UTR Luciferase Stable Cell Line

TU109888 1.0 ml Ask for price

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

SEH833Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

SEH833Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

SEH833Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

SEH833Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Iduronate-2-Sulfatase elisa. Alternative names of the recognized antigen: MPS2
  • SIDS
  • Hunter Syndrome
  • Idursulfase
  • Alpha-L-iduronate sulfate sulfatase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Ids 3'UTR GFP Stable Cell Line

TU159888 1.0 ml Ask for price

Ids 3'UTR Luciferase Stable Cell Line

TU206092 1.0 ml Ask for price

Ids 3'UTR GFP Stable Cell Line

TU256092 1.0 ml Ask for price

IDS 3'UTR GFP Stable Cell Line

TU060432 1.0 ml
EUR 4617

IDS 3'UTR Luciferase Stable Cell Line

TU010432 1.0 ml
EUR 4617

IDS Chemi-Luminescent ELISA Kit (Human) (OKCD03572)

OKCD03572 96 Wells
EUR 988
Description: Description of target: Required for the lysosomal degradation of heparan sulfate and dermatan sulfate. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

IDS ELISA Kit (Human) : 96 Wells (OKEH00295)

OKEH00295 96 Wells
EUR 662
Description: Description of target: Required for the lysosomal degradation of heparan sulfate and dermatan sulfate.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

IDS Rabbit Polyclonal Antibody