IDS Rabbit Polyclonal Antibody

IDS Rabbit Polyclonal Antibody

IDS Polyclonal Antibody
ES10912-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IDS from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

IDS Polyclonal Antibody
ES10912-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IDS from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
DLR-IDS-Hu-48T	DL Develop	48T	EUR 517
Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
DLR-IDS-Hu-96T	DL Develop	96T	EUR 673
Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
RDR-IDS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
RDR-IDS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
RD-IDS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
RD-IDS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

IDS Rabbit pAb
A1857-100ul	Abclonal	100 ul	EUR 308

IDS Rabbit pAb
A1857-200ul	Abclonal	200 ul	EUR 459

IDS Rabbit pAb
A1857-20ul	Abclonal	20 ul	EUR 183

IDS Rabbit pAb
A1857-50ul	Abclonal	50 ul	EUR 223

Polyclonal IDS Antibody (Internal)
APG01181G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IDS (Internal). This antibody is tested and proven to work in the following applications:

IDS Polyclonal Conjugated Antibody
C31899	SAB	100ul	EUR 397

IDS Polyclonal Conjugated Antibody
C30396	SAB	100ul	EUR 397

IDS antibody
70R-10208	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal IDS antibody

IDS antibody
31899-100ul	SAB	100ul	EUR 252

IDS antibody
31899-50ul	SAB	50ul	EUR 187

IDS antibody
10R-6986	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal IDS antibody

IDS antibody
10R-6987	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal IDS antibody

IDS antibody
10R-6988	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal IDS antibody

Rabbit IDS ELISA Kit
ERTI0341	Abclonal	96Tests	EUR 521

Polyclonal Goat Anti-IDS Antibody
APG00165G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-IDS . This antibody is tested and proven to work in the following applications:

Anti-IDS antibody
STJ24123	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed.

Anti-IDS antibody
STJ71754	St John's Laboratory	100 µg	EUR 359

Anti-IDS antibody
STJ192070	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to IDS

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse)
4-PAH833Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Leu180~Asp448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS)

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat)
4-PAH833Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Ile107~Thr363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS)

IDS siRNA
20-abx920158	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IDS siRNA
20-abx920159	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse)
4-PAH833Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Arg95~Pro289) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS)

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), APC
4-PAH833Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Leu180~Asp448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), Biotinylated
4-PAH833Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Leu180~Asp448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Biotin.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), Cy3
4-PAH833Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Leu180~Asp448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Cy3.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), FITC
4-PAH833Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Leu180~Asp448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with FITC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), HRP
4-PAH833Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Leu180~Asp448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with HRP.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), PE
4-PAH833Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Leu180~Asp448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with PE.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), APC
4-PAH833Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Ile107~Thr363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), Biotinylated
4-PAH833Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Ile107~Thr363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with Biotin.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), Cy3
4-PAH833Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Ile107~Thr363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with Cy3.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), FITC
4-PAH833Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Ile107~Thr363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with FITC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), HRP
4-PAH833Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Ile107~Thr363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with HRP.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), PE
4-PAH833Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Ile107~Thr363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with PE.

IDS Blocking Peptide
33R-8437	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IDS antibody, catalog no. 70R-10208

IDS cloning plasmid
CSB-CL010998HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 939 Sequence: atgccgccaccccggaccggccgaggccttctctggctgggtctggttctgagctccgtctgcgtcgccctcggatccgaaacgcaggccaactcgaccacagatgctctgaacgttcttctcatcatcgtggatgacctgcgcccctccctgggctgttatggggataagctggt Show more
Description: A cloning plasmid for the IDS gene.

Iduronate 2-Sulfatase (IDS) Antibody
20-abx006700	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Antibody
20-abx102026	Abbexa	EUR 314.00 EUR 133.00 EUR 815.00 EUR 425.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Iduronate-2-Sulfatase (IDS) Antibody
20-abx102027	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Iduronate-2-Sulfatase (IDS) Antibody
20-abx130132	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Iduronate 2-Sulfatase (IDS) Antibody
abx145606-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Antibody
20-abx172861	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Iduronate 2-Sulfatase (IDS) Antibody
abx432837-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), APC
4-PAH833Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Arg95~Pro289) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAH833Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Arg95~Pro289) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Biotin.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), Cy3
4-PAH833Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Arg95~Pro289) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Cy3.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), FITC
4-PAH833Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Arg95~Pro289) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with FITC.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), HRP
4-PAH833Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Arg95~Pro289) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with HRP.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), PE
4-PAH833Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Arg95~Pro289) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with PE.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH833Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Leu180~Asp448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC-Cy7.

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), APC-Cy7
4-PAH833Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Ile107~Thr363) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC-Cy7.

Anti-Iduronate 2 sulfatase/IDS Antibody
PA1917	BosterBio	100ug/vial	EUR 334

Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAH833Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IDS (Arg95~Pro289) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC-Cy7.

Human IDS ELISA Kit
ELA-E0204h	Lifescience Market	96 Tests	EUR 824

Human IDS ELISA Kit
EHI0341	Abclonal	96Tests	EUR 521

Bovine IDS ELISA Kit
EBI0341	Abclonal	96Tests	EUR 521

Canine IDS ELISA Kit
ECI0341	Abclonal	96Tests	EUR 521

Anserini IDS ELISA Kit
EAI0341	Abclonal	96Tests	EUR 521

Goat IDS ELISA Kit
EGTI0341	Abclonal	96Tests	EUR 521

IDS ELISA KIT|Human
EF006009	Lifescience Market	96 Tests	EUR 689

Human IDS shRNA Plasmid
20-abx952318	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse IDS shRNA Plasmid
20-abx970965	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Porcine IDS ELISA Kit
EPI0341	Abclonal	96Tests	EUR 521

Rat IDS ELISA Kit
ERI0341	Abclonal	96Tests	EUR 521

Mouse IDS ELISA Kit
EMI0341	Abclonal	96Tests	EUR 521

IDS Recombinant Protein (Human)
RP015568	ABM	100 ug	Ask for price

IDS Recombinant Protein (Mouse)
RP142919	ABM	100 ug	Ask for price

Monoclonal IDS Antibody (clone 3B10), Clone: 3B10
AMM02257G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human IDS (clone 3B10). The antibodies are raised in Mouse and are from clone 3B10. This antibody is applicable in WB and IHC-P, IF, Flo

Monoclonal IDS Antibody (clone 3B4), Clone: 3B4
AMM02300G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human IDS (clone 3B4). The antibodies are raised in Mouse and are from clone 3B4. This antibody is applicable in WB and IHC-P, E

ELISA kit for Human IDS
EK5680	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human IDS in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse IDS
EK5681	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse IDS in samples from serum, plasma, tissue homogenates and other biological fluids.

Human IDS PicoKine ELISA Kit
EK1452	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human IDS in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse IDS PicoKine ELISA Kit
EK1453	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse IDS in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Guinea Pig IDS ELISA Kit
EGI0341	Abclonal	96Tests	EUR 521

IDS ORF Vector (Human) (pORF)
ORF005190	ABM	1.0 ug DNA	EUR 95

Ids ORF Vector (Mouse) (pORF)
ORF047641	ABM	1.0 ug DNA	EUR 506

Recombinant Iduronate-2-Sulfatase (IDS)
4-RPH833Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P22304 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 23.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Iduronate-2-Sulfatase expressed in: E.coli

Recombinant Iduronate-2-Sulfatase (IDS)
4-RPH833Mu01	Cloud-Clone	EUR 519.33 EUR 242.00 EUR 1672.48 EUR 624.16 EUR 1148.32 EUR 410.00 EUR 4031.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q08890 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.8kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Iduronate-2-Sulfatase expressed in: E.coli

Recombinant Iduronate-2-Sulfatase (IDS)
4-RPH833Ra01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: F1LLW8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 59.3kDa Isoelectric Point: Inquire
Description: Recombinant Rat Iduronate-2-Sulfatase expressed in: E.coli

pECMV-Ids-m-FLAG Plasmid
PVT15700	Lifescience Market	2 ug	EUR 325

IDS ELISA Kit (Human) (OKAN05423)
OKAN05423	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

IDS ELISA Kit (Human) (OKBB01001)
OKBB01001	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Iduronate 2-sulfatase (IDS) is a sulfatase enzyme associated with Hunter syndrome. It encodes a member of the sulfatase family of proteins. Iduronate 2-sulfatase is involved in the lysosomal degradation of the glycosaminoglycans heparan sulfate and dermatan sulfate. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <15pg/ml

IDS ELISA Kit (Mouse) (OKBB01002)
OKBB01002	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Iduronate 2-sulfatase (IDS) is a sulfatase enzyme associated with Hunter syndrome. It encodes a member of the sulfatase family of proteins. Iduronate 2-sulfatase is involved in the lysosomal degradation of the glycosaminoglycans heparan sulfate and dermatan sulfate. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <15pg/ml

IDS ELISA Kit (Human) (OKCD09108)
OKCD09108	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Iduronate-2-sulfatase is required for the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this X-chromosome gene that result in enzymatic deficiency lead to the sex-linked Mucopolysaccharidosis Type II, also known as Hunter Syndrome. Iduronate-2-sulfatase has a strong sequence similarity with human arylsulfatases A, B, and C, and human glucosamine-6-sulfatase. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

IDS ELISA Kit (Mouse) (OKEH05904)
OKEH05904	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Required for the lysosomal degradation of heparan sulfate and dermatan sulfate.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL

IDS ELISA Kit (Rat) (OKEI00788)
OKEI00788	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL

Human iduronate sulfatase,IDS ELISA Kit
201-12-0731	SunredBio	96 tests	EUR 440
This iduronate sulfatase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Rat Iduronate-2-Sulfatase (IDS) Protein
20-abx168502	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Iduronate-2-Sulfatase (IDS) Protein
20-abx067169	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Iduronate-2-Sulfatase (IDS) Protein
20-abx067170	Abbexa	EUR 718.00 EUR 286.00 EUR 2249.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat iduronate sulfatase,IDS ELISA Kit
CN-02004R1	ChemNorm	96T	EUR 468

Rat iduronate sulfatase,IDS ELISA Kit
CN-02004R2	ChemNorm	48T	EUR 318

Human iduronate sulfatase,IDS ELISA Kit
CN-04541H1	ChemNorm	96T	EUR 448

Human iduronate sulfatase,IDS ELISA Kit
CN-04541H2	ChemNorm	48T	EUR 297

Human iduronate sulfatase, IDS ELISA Kit
CSB-E09471h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human iduronate sulfatase, IDS ELISA Kit
1-CSB-E09471h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Iduronate Sulfatase (IDS) ELISA Kit
abx570921-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human iduronate sulfatase(IDS)ELISA Kit
GA-E0747HM-48T	GenAsia Biotech	48T	EUR 289

Human iduronate sulfatase(IDS)ELISA Kit
GA-E0747HM-96T	GenAsia Biotech	96T	EUR 466

Rat iduronate sulfatase(IDS)ELISA Kit
GA-E0115RT-48T	GenAsia Biotech	48T	EUR 317

Rat iduronate sulfatase(IDS)ELISA Kit
GA-E0115RT-96T	GenAsia Biotech	96T	EUR 496

Ids sgRNA CRISPR Lentivector set (Mouse)
K3827101	ABM	3 x 1.0 ug	EUR 339

IDS sgRNA CRISPR Lentivector set (Human)
K1015501	ABM	3 x 1.0 ug	EUR 339

Human iduronate sulfatase(IDS)ELISA Kit
QY-E04351	Qayee Biotechnology	96T	EUR 361

Rat iduronate sulfatase(IDS)ELISA Kit
QY-E11538	Qayee Biotechnology	96T	EUR 361

Mouse iduronate sulfatase(IDS)ELISA Kit
QY-E20773	Qayee Biotechnology	96T	EUR 361

ELISA kit for Rat IDS (Iduronate Sulfatase)
E-EL-R0514	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's IDS ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat IDS. Standards or samples are added to the micro ELISA plate wells and combined with the sp Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat IDS (Iduronate Sulfatase) in samples from Serum, Plasma, Cell supernatant

Human Iduronate-2-Sulfatase (IDS) CLIA Kit
20-abx190349	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
20-abx151901	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Iduronate 2-Sulfatase (IDS) ELISA Kit
abx253725-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human IDS/ Iduronate 2-sulfatase ELISA Kit
E1209Hu	Sunlong	1 Kit	EUR 571

Human IDS(Iduronate 2-sulfatase) ELISA Kit
EH0767	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: P22304 Alias: IDS/SIDS/MPS2/S/Alpha-L-iduronate sulfate sulfatase/iduronate 2-sulfatase/iduronate 2-sulfatase 14 kDa chain/iduronate 2-sulfatase 42 kDa chain/idursulfase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse Iduronate 2-Sulfatase (Ids) ELISA Kit
abx512185-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Ids sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3827102	ABM	1.0 ug DNA	EUR 154

Ids sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3827103	ABM	1.0 ug DNA	EUR 154

Ids sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3827104	ABM	1.0 ug DNA	EUR 154

IDS sgRNA CRISPR Lentivector (Human) (Target 1)
K1015502	ABM	1.0 ug DNA	EUR 154

IDS sgRNA CRISPR Lentivector (Human) (Target 2)
K1015503	ABM	1.0 ug DNA	EUR 154

IDS sgRNA CRISPR Lentivector (Human) (Target 3)
K1015504	ABM	1.0 ug DNA	EUR 154

IDS Iduronate 2-Sulfatase Human Recombinant Protein
PROTP22304	BosterBio	Regular: 10ug	EUR 317
Description: IDS Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 533 amino acids (26-550a.a) and having a molecular mass of 60.3kDa. (Molecular size on SDS-PAGE will appear at approximately 35-70kDa). IDS is fused to an 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

IDS Protein Vector (Human) (pPB-C-His)
PV020757	ABM	500 ng	EUR 329

IDS Protein Vector (Human) (pPB-N-His)
PV020758	ABM	500 ng	EUR 329

IDS Protein Vector (Human) (pPM-C-HA)
PV020759	ABM	500 ng	EUR 329

IDS Protein Vector (Human) (pPM-C-His)
PV020760	ABM	500 ng	EUR 329

IDS Protein Vector (Mouse) (pPB-C-His)
PV190562	ABM	500 ng	EUR 603

IDS Protein Vector (Mouse) (pPB-N-His)
PV190563	ABM	500 ng	EUR 603

IDS Protein Vector (Mouse) (pPM-C-HA)
PV190564	ABM	500 ng	EUR 603

IDS Protein Vector (Mouse) (pPM-C-His)
PV190565	ABM	500 ng	EUR 603

Human Iduronate-2-Sulfatase ELISA Kit (IDS)
RK01625	Abclonal	96 Tests	EUR 521

Human Iduronate-2-Sulfatase (IDS)CLIA Kit
SCH833Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit
SCH833Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit
SCH833Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit
SCH833Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) CLIA Kit
4-SCH833Hu	Cloud-Clone	EUR 5698.00 EUR 3061.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Iduronate-2-Sulfatase Clia kit. Alternative names of the recognized antigen: MPS2 SIDS Hunter Syndrome Idursulfase Alpha-L-iduronate sulfate sulfatase
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS)Tissue homogenates and other biological fluids

Recombinant Human IDS Protein, His, Insect-10ug
QP12369-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human IDS Protein, His, Insect-1mg
QP12369-1mg	EnQuireBio	1mg	EUR 5251

Recombinant Human IDS Protein, His, Insect-2ug
QP12369-2ug	EnQuireBio	2ug	EUR 155

Ids 3'UTR Luciferase Stable Cell Line
TU109888	ABM	1.0 ml	Ask for price

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
SEH833Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
SEH833Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
SEH833Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
SEH833Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
4-SEH833Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Iduronate-2-Sulfatase elisa. Alternative names of the recognized antigen: MPS2 SIDS Hunter Syndrome Idursulfase Alpha-L-iduronate sulfate sulfatase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Ids 3'UTR GFP Stable Cell Line
TU159888	ABM	1.0 ml	Ask for price

Ids 3'UTR Luciferase Stable Cell Line
TU206092	ABM	1.0 ml	Ask for price

Ids 3'UTR GFP Stable Cell Line
TU256092	ABM	1.0 ml	Ask for price

IDS 3'UTR GFP Stable Cell Line
TU060432	ABM	1.0 ml	EUR 4617

IDS 3'UTR Luciferase Stable Cell Line
TU010432	ABM	1.0 ml	EUR 4617

IDS Chemi-Luminescent ELISA Kit (Human) (OKCD03572)
OKCD03572	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: Required for the lysosomal degradation of heparan sulfate and dermatan sulfate. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

IDS ELISA Kit (Human) : 96 Wells (OKEH00295)
OKEH00295	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Required for the lysosomal degradation of heparan sulfate and dermatan sulfate.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

IDS Rabbit Polyclonal Antibody