IDS Rabbit Polyclonal Antibody
IDS Polyclonal Antibody |
ES10912-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IDS from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IDS Polyclonal Antibody |
ES10912-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IDS from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Iduronate-2-Sulfatase (IDS) ELISA Kit |
DLR-IDS-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Iduronate-2-Sulfatase (IDS) ELISA Kit |
DLR-IDS-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Iduronate-2-Sulfatase (IDS) ELISA Kit |
RDR-IDS-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Iduronate-2-Sulfatase (IDS) ELISA Kit |
RDR-IDS-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Iduronate-2-Sulfatase (IDS) ELISA Kit |
RD-IDS-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Iduronate-2-Sulfatase (IDS) ELISA Kit |
RD-IDS-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
IDS Rabbit pAb |
A1857-100ul |
Abclonal |
100 ul |
EUR 308 |
IDS Rabbit pAb |
A1857-200ul |
Abclonal |
200 ul |
EUR 459 |
IDS Rabbit pAb |
A1857-20ul |
Abclonal |
20 ul |
EUR 183 |
IDS Rabbit pAb |
A1857-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal IDS Antibody (Internal) |
APG01181G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IDS (Internal). This antibody is tested and proven to work in the following applications: |
IDS Polyclonal Conjugated Antibody |
C31899 |
SAB |
100ul |
EUR 397 |
IDS Polyclonal Conjugated Antibody |
C30396 |
SAB |
100ul |
EUR 397 |
IDS antibody |
70R-10208 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal IDS antibody |
IDS antibody |
31899-100ul |
SAB |
100ul |
EUR 252 |
IDS antibody |
31899-50ul |
SAB |
50ul |
EUR 187 |
IDS antibody |
10R-6986 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal IDS antibody |
IDS antibody |
10R-6987 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal IDS antibody |
IDS antibody |
10R-6988 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal IDS antibody |
Rabbit IDS ELISA Kit |
ERTI0341 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal Goat Anti-IDS Antibody |
APG00165G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-IDS . This antibody is tested and proven to work in the following applications: |
Anti-IDS antibody |
STJ24123 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. |
Anti-IDS antibody |
STJ192070 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to IDS |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse) |
4-PAH833Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Leu180~Asp448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS) |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat) |
4-PAH833Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Ile107~Thr363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS) |
IDS siRNA |
20-abx920158 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IDS siRNA |
20-abx920159 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse) |
4-PAH833Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Arg95~Pro289)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS) |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), APC |
4-PAH833Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Leu180~Asp448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), Biotinylated |
4-PAH833Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Leu180~Asp448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Biotin. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), Cy3 |
4-PAH833Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Leu180~Asp448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Cy3. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), FITC |
4-PAH833Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Leu180~Asp448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with FITC. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), HRP |
4-PAH833Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Leu180~Asp448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with HRP. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), PE |
4-PAH833Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Leu180~Asp448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with PE. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), APC |
4-PAH833Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Ile107~Thr363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), Biotinylated |
4-PAH833Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Ile107~Thr363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with Biotin. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), Cy3 |
4-PAH833Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Ile107~Thr363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with Cy3. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), FITC |
4-PAH833Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Ile107~Thr363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with FITC. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), HRP |
4-PAH833Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Ile107~Thr363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with HRP. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), PE |
4-PAH833Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Ile107~Thr363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with PE. |
IDS Blocking Peptide |
33R-8437 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IDS antibody, catalog no. 70R-10208 |
IDS cloning plasmid |
CSB-CL010998HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 939
- Sequence: atgccgccaccccggaccggccgaggccttctctggctgggtctggttctgagctccgtctgcgtcgccctcggatccgaaacgcaggccaactcgaccacagatgctctgaacgttcttctcatcatcgtggatgacctgcgcccctccctgggctgttatggggataagctggt
- Show more
|
Description: A cloning plasmid for the IDS gene. |
Iduronate 2-Sulfatase (IDS) Antibody |
20-abx006700 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Iduronate-2-Sulfatase (IDS) Antibody |
20-abx102026 |
Abbexa |
-
EUR 314.00
-
EUR 133.00
-
EUR 815.00
-
EUR 425.00
-
EUR 272.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Iduronate-2-Sulfatase (IDS) Antibody |
20-abx102027 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Iduronate-2-Sulfatase (IDS) Antibody |
20-abx130132 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Iduronate 2-Sulfatase (IDS) Antibody |
abx145606-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Iduronate-2-Sulfatase (IDS) Antibody |
20-abx172861 |
Abbexa |
|
|
|
Iduronate 2-Sulfatase (IDS) Antibody |
abx432837-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), APC |
4-PAH833Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Arg95~Pro289)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAH833Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Arg95~Pro289)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Biotin. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAH833Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Arg95~Pro289)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with Cy3. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), FITC |
4-PAH833Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Arg95~Pro289)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with FITC. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), HRP |
4-PAH833Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Arg95~Pro289)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with HRP. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), PE |
4-PAH833Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Arg95~Pro289)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with PE. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAH833Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Leu180~Asp448)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC-Cy7. |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAH833Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Ile107~Thr363)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC-Cy7. |
Anti-Iduronate 2 sulfatase/IDS Antibody |
PA1917 |
BosterBio |
100ug/vial |
EUR 334 |
Iduronate-2-Sulfatase (IDS) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAH833Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IDS (Arg95~Pro289)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Iduronate-2-Sulfatase (IDS). This antibody is labeled with APC-Cy7. |
Human IDS ELISA Kit |
EHI0341 |
Abclonal |
96Tests |
EUR 521 |
Bovine IDS ELISA Kit |
EBI0341 |
Abclonal |
96Tests |
EUR 521 |
Canine IDS ELISA Kit |
ECI0341 |
Abclonal |
96Tests |
EUR 521 |
Anserini IDS ELISA Kit |
EAI0341 |
Abclonal |
96Tests |
EUR 521 |
Goat IDS ELISA Kit |
EGTI0341 |
Abclonal |
96Tests |
EUR 521 |
Human IDS shRNA Plasmid |
20-abx952318 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse IDS shRNA Plasmid |
20-abx970965 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Porcine IDS ELISA Kit |
EPI0341 |
Abclonal |
96Tests |
EUR 521 |
Rat IDS ELISA Kit |
ERI0341 |
Abclonal |
96Tests |
EUR 521 |
Mouse IDS ELISA Kit |
EMI0341 |
Abclonal |
96Tests |
EUR 521 |
IDS Recombinant Protein (Human) |
RP015568 |
ABM |
100 ug |
Ask for price |
IDS Recombinant Protein (Mouse) |
RP142919 |
ABM |
100 ug |
Ask for price |
Monoclonal IDS Antibody (clone 3B10), Clone: 3B10 |
AMM02257G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human IDS (clone 3B10). The antibodies are raised in Mouse and are from clone 3B10. This antibody is applicable in WB and IHC-P, IF, Flo |
Monoclonal IDS Antibody (clone 3B4), Clone: 3B4 |
AMM02300G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human IDS (clone 3B4). The antibodies are raised in Mouse and are from clone 3B4. This antibody is applicable in WB and IHC-P, E |
ELISA kit for Human IDS |
EK5680 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human IDS in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Mouse IDS |
EK5681 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse IDS in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human IDS PicoKine ELISA Kit |
EK1452 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human IDS in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
Mouse IDS PicoKine ELISA Kit |
EK1453 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse IDS in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
Guinea Pig IDS ELISA Kit |
EGI0341 |
Abclonal |
96Tests |
EUR 521 |
IDS ORF Vector (Human) (pORF) |
ORF005190 |
ABM |
1.0 ug DNA |
EUR 95 |
Ids ORF Vector (Mouse) (pORF) |
ORF047641 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Iduronate-2-Sulfatase (IDS) |
4-RPH833Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P22304
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Iduronate-2-Sulfatase expressed in: E.coli |
Recombinant Iduronate-2-Sulfatase (IDS) |
4-RPH833Mu01 |
Cloud-Clone |
-
EUR 519.33
-
EUR 242.00
-
EUR 1672.48
-
EUR 624.16
-
EUR 1148.32
-
EUR 410.00
-
EUR 4031.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q08890
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Iduronate-2-Sulfatase expressed in: E.coli |
Recombinant Iduronate-2-Sulfatase (IDS) |
4-RPH833Ra01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: F1LLW8
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 59.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Iduronate-2-Sulfatase expressed in: E.coli |
IDS ELISA Kit (Human) (OKAN05423) |
OKAN05423 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL |
IDS ELISA Kit (Human) (OKBB01001) |
OKBB01001 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Iduronate 2-sulfatase (IDS) is a sulfatase enzyme associated with Hunter syndrome. It encodes a member of the sulfatase family of proteins. Iduronate 2-sulfatase is involved in the lysosomal degradation of the glycosaminoglycans heparan sulfate and dermatan sulfate. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <15pg/ml |
IDS ELISA Kit (Mouse) (OKBB01002) |
OKBB01002 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Iduronate 2-sulfatase (IDS) is a sulfatase enzyme associated with Hunter syndrome. It encodes a member of the sulfatase family of proteins. Iduronate 2-sulfatase is involved in the lysosomal degradation of the glycosaminoglycans heparan sulfate and dermatan sulfate. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <15pg/ml |
IDS ELISA Kit (Human) (OKCD09108) |
OKCD09108 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Iduronate-2-sulfatase is required for the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this X-chromosome gene that result in enzymatic deficiency lead to the sex-linked Mucopolysaccharidosis Type II, also known as Hunter Syndrome. Iduronate-2-sulfatase has a strong sequence similarity with human arylsulfatases A, B, and C, and human glucosamine-6-sulfatase. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL |
IDS ELISA Kit (Mouse) (OKEH05904) |
OKEH05904 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Required for the lysosomal degradation of heparan sulfate and dermatan sulfate.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL |
IDS ELISA Kit (Rat) (OKEI00788) |
OKEI00788 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL |
Human iduronate sulfatase,IDS ELISA Kit |
201-12-0731 |
SunredBio |
96 tests |
EUR 440 |
- This iduronate sulfatase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Rat Iduronate-2-Sulfatase (IDS) Protein |
20-abx168502 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Iduronate-2-Sulfatase (IDS) Protein |
20-abx067169 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Iduronate-2-Sulfatase (IDS) Protein |
20-abx067170 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2249.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat iduronate sulfatase,IDS ELISA Kit |
CN-02004R1 |
ChemNorm |
96T |
EUR 468 |
Rat iduronate sulfatase,IDS ELISA Kit |
CN-02004R2 |
ChemNorm |
48T |
EUR 318 |
Human iduronate sulfatase,IDS ELISA Kit |
CN-04541H1 |
ChemNorm |
96T |
EUR 448 |
Human iduronate sulfatase,IDS ELISA Kit |
CN-04541H2 |
ChemNorm |
48T |
EUR 297 |
Human iduronate sulfatase, IDS ELISA Kit |
CSB-E09471h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human iduronate sulfatase, IDS ELISA Kit |
1-CSB-E09471h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Iduronate Sulfatase (IDS) ELISA Kit |
abx570921-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human iduronate sulfatase(IDS)ELISA Kit |
GA-E0747HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human iduronate sulfatase(IDS)ELISA Kit |
GA-E0747HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Rat iduronate sulfatase(IDS)ELISA Kit |
GA-E0115RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat iduronate sulfatase(IDS)ELISA Kit |
GA-E0115RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
Ids sgRNA CRISPR Lentivector set (Mouse) |
K3827101 |
ABM |
3 x 1.0 ug |
EUR 339 |
IDS sgRNA CRISPR Lentivector set (Human) |
K1015501 |
ABM |
3 x 1.0 ug |
EUR 339 |
ELISA kit for Rat IDS (Iduronate Sulfatase) |
E-EL-R0514 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's IDS ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat IDS. Standards or samples are added to the micro ELISA plate wells and combined with the sp
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat IDS (Iduronate Sulfatase) in samples from Serum, Plasma, Cell supernatant |
Human Iduronate-2-Sulfatase (IDS) CLIA Kit |
20-abx190349 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Iduronate-2-Sulfatase (IDS) ELISA Kit |
20-abx151901 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Iduronate 2-Sulfatase (IDS) ELISA Kit |
abx253725-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human IDS/ Iduronate 2-sulfatase ELISA Kit |
E1209Hu |
Sunlong |
1 Kit |
EUR 571 |
Human IDS(Iduronate 2-sulfatase) ELISA Kit |
EH0767 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: P22304
- Alias: IDS/SIDS/MPS2/S/Alpha-L-iduronate sulfate sulfatase/iduronate 2-sulfatase/iduronate 2-sulfatase 14 kDa chain/iduronate 2-sulfatase 42 kDa chain/idursulfase
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Mouse Iduronate 2-Sulfatase (Ids) ELISA Kit |
abx512185-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Ids sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3827102 |
ABM |
1.0 ug DNA |
EUR 154 |
Ids sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3827103 |
ABM |
1.0 ug DNA |
EUR 154 |
Ids sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3827104 |
ABM |
1.0 ug DNA |
EUR 154 |
IDS sgRNA CRISPR Lentivector (Human) (Target 1) |
K1015502 |
ABM |
1.0 ug DNA |
EUR 154 |
IDS sgRNA CRISPR Lentivector (Human) (Target 2) |
K1015503 |
ABM |
1.0 ug DNA |
EUR 154 |
IDS sgRNA CRISPR Lentivector (Human) (Target 3) |
K1015504 |
ABM |
1.0 ug DNA |
EUR 154 |
IDS Iduronate 2-Sulfatase Human Recombinant Protein |
PROTP22304 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: IDS Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 533 amino acids (26-550a.a) and having a molecular mass of 60.3kDa. (Molecular size on SDS-PAGE will appear at approximately 35-70kDa). IDS is fused to an 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques. |
IDS Protein Vector (Human) (pPB-C-His) |
PV020757 |
ABM |
500 ng |
EUR 329 |
IDS Protein Vector (Human) (pPB-N-His) |
PV020758 |
ABM |
500 ng |
EUR 329 |
IDS Protein Vector (Human) (pPM-C-HA) |
PV020759 |
ABM |
500 ng |
EUR 329 |
IDS Protein Vector (Human) (pPM-C-His) |
PV020760 |
ABM |
500 ng |
EUR 329 |
IDS Protein Vector (Mouse) (pPB-C-His) |
PV190562 |
ABM |
500 ng |
EUR 603 |
IDS Protein Vector (Mouse) (pPB-N-His) |
PV190563 |
ABM |
500 ng |
EUR 603 |
IDS Protein Vector (Mouse) (pPM-C-HA) |
PV190564 |
ABM |
500 ng |
EUR 603 |
IDS Protein Vector (Mouse) (pPM-C-His) |
PV190565 |
ABM |
500 ng |
EUR 603 |
Human Iduronate-2-Sulfatase ELISA Kit (IDS) |
RK01625 |
Abclonal |
96 Tests |
EUR 521 |
Human Iduronate-2-Sulfatase (IDS)CLIA Kit |
SCH833Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5647.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids. |
Human Iduronate-2-Sulfatase (IDS)CLIA Kit |
SCH833Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 552.76 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids. |
Human Iduronate-2-Sulfatase (IDS)CLIA Kit |
SCH833Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 746.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids. |
Human Iduronate-2-Sulfatase (IDS)CLIA Kit |
SCH833Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3060.6 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids. |
Human Iduronate-2-Sulfatase (IDS) CLIA Kit |
4-SCH833Hu |
Cloud-Clone |
-
EUR 5698.00
-
EUR 3061.00
-
EUR 747.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Iduronate-2-Sulfatase Clia kit. Alternative names of the recognized antigen: MPS2
- SIDS
- Hunter Syndrome
- Idursulfase
- Alpha-L-iduronate sulfate sulfatase
|
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS)Tissue homogenates and other biological fluids |
Recombinant Human IDS Protein, His, Insect-10ug |
QP12369-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human IDS Protein, His, Insect-1mg |
QP12369-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human IDS Protein, His, Insect-2ug |
QP12369-2ug |
EnQuireBio |
2ug |
EUR 155 |
Ids 3'UTR Luciferase Stable Cell Line |
TU109888 |
ABM |
1.0 ml |
Ask for price |
Human Iduronate-2-Sulfatase (IDS) ELISA Kit |
SEH833Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids. |
Human Iduronate-2-Sulfatase (IDS) ELISA Kit |
SEH833Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids. |
Human Iduronate-2-Sulfatase (IDS) ELISA Kit |
SEH833Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids. |
Human Iduronate-2-Sulfatase (IDS) ELISA Kit |
SEH833Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids. |
Human Iduronate-2-Sulfatase (IDS) ELISA Kit |
4-SEH833Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Iduronate-2-Sulfatase elisa. Alternative names of the recognized antigen: MPS2
- SIDS
- Hunter Syndrome
- Idursulfase
- Alpha-L-iduronate sulfate sulfatase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Ids 3'UTR GFP Stable Cell Line |
TU159888 |
ABM |
1.0 ml |
Ask for price |
Ids 3'UTR Luciferase Stable Cell Line |
TU206092 |
ABM |
1.0 ml |
Ask for price |
Ids 3'UTR GFP Stable Cell Line |
TU256092 |
ABM |
1.0 ml |
Ask for price |
IDS 3'UTR GFP Stable Cell Line |
TU060432 |
ABM |
1.0 ml |
EUR 4617 |
IDS 3'UTR Luciferase Stable Cell Line |
TU010432 |
ABM |
1.0 ml |
EUR 4617 |
IDS Chemi-Luminescent ELISA Kit (Human) (OKCD03572) |
OKCD03572 |
Aviva Systems Biology |
96 Wells |
EUR 988 |
Description: Description of target: Required for the lysosomal degradation of heparan sulfate and dermatan sulfate. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL |
IDS ELISA Kit (Human) : 96 Wells (OKEH00295) |
OKEH00295 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Required for the lysosomal degradation of heparan sulfate and dermatan sulfate.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
IDS Rabbit Polyclonal Antibody