Da vinci european bio bank

IFNA4 Rabbit Polyclonal Antibody

IFNA4 Polyclonal Antibody
ABP58887-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human IFNA4 protein Applications tips:
Description: A polyclonal antibody for detection of IFNA4 from Human. This IFNA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFNA4 protein

IFNA4 Polyclonal Antibody
ABP58887-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human IFNA4 protein Applications tips:
Description: A polyclonal antibody for detection of IFNA4 from Human. This IFNA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFNA4 protein

IFNA4 Polyclonal Antibody
ES10706-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IFNA4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

IFNA4 Polyclonal Antibody
ES10706-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IFNA4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Interferon Alpha 4 (IFNa4) ELISA Kit
DLR-IFNa4-Hu-48T	DL Develop	48T	EUR 425
Should the Human Interferon Alpha 4 (IFNa4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Alpha 4 (IFNa4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Interferon Alpha 4 (IFNa4) ELISA Kit
DLR-IFNa4-Hu-96T	DL Develop	96T	EUR 548
Should the Human Interferon Alpha 4 (IFNa4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Alpha 4 (IFNa4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Interferon Alpha 4 (IFNa4) ELISA Kit
RDR-IFNa4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436

Human Interferon Alpha 4 (IFNa4) ELISA Kit
RDR-IFNa4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601

Human Interferon Alpha 4 (IFNa4) ELISA Kit
RD-IFNa4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 418

Human Interferon Alpha 4 (IFNa4) ELISA Kit
RD-IFNa4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 575

IFNA4 Rabbit pAb
A8124-100ul	Abclonal	100 ul	EUR 308

IFNA4 Rabbit pAb
A8124-200ul	Abclonal	200 ul	EUR 459

IFNA4 Rabbit pAb
A8124-20ul	Abclonal	20 ul	EUR 183

IFNA4 Rabbit pAb
A8124-50ul	Abclonal	50 ul	EUR 223

IFNA4 Antibody
44812-100ul	SAB	100ul	EUR 252

IFNA4 Antibody
44812-50ul	SAB	50ul	EUR 187

IFNA4 Antibody
DF2515	Affbiotech	200ul	EUR 304
Description: IFNA4 antibody detects endogenous levels of total IFNA4.

IFNA4 Antibody
1-CSB-PA011040ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

IFNA4 Antibody
1-CSB-PA011040LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

IFNA4 Antibody
ABD2515	Lifescience Market	100 ug	EUR 438

IFNA4 Polyclonal Antibody, HRP Conjugated
A56960	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

IFNA4 Polyclonal Antibody, FITC Conjugated
A56961	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

IFNA4 Polyclonal Antibody, Biotin Conjugated
A56962	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

IFNA4 Conjugated Antibody
C44812	SAB	100ul	EUR 397

Anti-IFNA4 antibody
STJ117849	St John's Laboratory	100 µl	EUR 277

Anti-IFNA4 antibody
STJ191864	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to IFNA4

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human)
4-PAA175Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Ala10~Ala163) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4)

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat)
4-PAA175Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Arg33~Lys189) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4)

IFNA4 siRNA
20-abx920226	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IFNA4 siRNA
20-abx920227	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-IFNA4
YF-PA12567	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to IFNA4

anti-IFNA4
YF-PA12568	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to IFNA4

anti-IFNA4
YF-PA12569	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to IFNA4

IFNA4 Antibody, HRP conjugated
1-CSB-PA011040LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IFNA4 Antibody, FITC conjugated
1-CSB-PA011040LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IFNA4 Antibody, Biotin conjugated
1-CSB-PA011040LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), APC
4-PAA175Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Ala10~Ala163) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with APC.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), Biotinylated
4-PAA175Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Ala10~Ala163) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with Biotin.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), Cy3
4-PAA175Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Ala10~Ala163) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with Cy3.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), FITC
4-PAA175Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Ala10~Ala163) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with FITC.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), HRP
4-PAA175Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Ala10~Ala163) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with HRP.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), PE
4-PAA175Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Ala10~Ala163) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with PE.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat)
4-PAA175Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Asp26~Glu186) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4)

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), APC
4-PAA175Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Arg33~Lys189) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with APC.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), Biotinylated
4-PAA175Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Arg33~Lys189) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with Biotin.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), Cy3
4-PAA175Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Arg33~Lys189) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with Cy3.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), FITC
4-PAA175Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Arg33~Lys189) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with FITC.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), HRP
4-PAA175Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Arg33~Lys189) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with HRP.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), PE
4-PAA175Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Arg33~Lys189) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with PE.

IFNA4 Blocking Peptide
DF2515-BP	Affbiotech	1mg	EUR 195

IFNA4 cloning plasmid
CSB-CL011040HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 570 Sequence: atggccctgtccttttctttactgatggccgtgctggtgctcagctacaaatccatctgttctctgggctgtgatctgcctcagacccacagcctgggtaataggagggccttgatactcctggcacaaatgggaagaatctctcatttctcctgcctgaaggacagacatgattt Show more
Description: A cloning plasmid for the IFNA4 gene.

IFNA4 cloning plasmid
CSB-CL011040HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 570 Sequence: atggccctgtccttttctttactgatggccgtgctggtgctcagctacaaatccatctgttctctgggctgtgatctgcctcagacccacagcctgggtaataggagggccttgatactcctggcacaaatgggaagaatctctcatttctcctgcctgaaggacagacatgattt Show more
Description: A cloning plasmid for the IFNA4 gene.

Interferon Alpha 4 (IFNA4) Antibody
20-abx216154	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Interferon Alpha 4 (IFNa4) Antibody
20-abx101877	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interferon Alpha 4 (IFNa4) Antibody
20-abx101878	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interferon Alpha 4 (IFNa4) Antibody
20-abx101879	Abbexa	EUR 300.00 EUR 133.00 EUR 801.00 EUR 425.00 EUR 258.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interferon Alpha 4 (IFNa4) Antibody
20-abx172993	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Interferon Alpha 4 (IFNA4) Antibody
abx034855-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Interferon Alpha 4 (IFNA4) Antibody
abx034855-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Interferon Alpha 4 (IFNA4) Antibody
20-abx320564	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Interferon Alpha 4 (IFNA4) Antibody
20-abx317914	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), APC-Cy7
4-PAA175Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Ala10~Ala163) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with APC-Cy7.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), APC
4-PAA175Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Asp26~Glu186) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with APC.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAA175Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Asp26~Glu186) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with Biotin.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAA175Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Asp26~Glu186) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with Cy3.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), FITC
4-PAA175Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Asp26~Glu186) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with FITC.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), HRP
4-PAA175Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Asp26~Glu186) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with HRP.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), PE
4-PAA175Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Asp26~Glu186) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with PE.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), APC-Cy7
4-PAA175Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Arg33~Lys189) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with APC-Cy7.

Interferon Alpha 4 (IFNa4) Antibody (Biotin)
20-abx273015	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Interferon Alpha 4 (IFNA4) Antibody (HRP)
20-abx304208	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Interferon Alpha 4 (IFNA4) Antibody (FITC)
20-abx304209	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Interferon Alpha 4 (IFNA4) Antibody (Biotin)
20-abx304210	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAA175Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IFNa4 (Asp26~Glu186) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with APC-Cy7.

Human IFNA4 shRNA Plasmid
20-abx952330	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse IFNA4 shRNA Plasmid
20-abx970976	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Interferon alpha-4 (IFNA4)
1-CSB-EP011040HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 35.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Interferon alpha-4(IFNA4),partial expressed in E.coli

Ifna4 ORF Vector (Rat) (pORF)
ORF068514	ABM	1.0 ug DNA	EUR 506

IFNA4 ORF Vector (Human) (pORF)
ORF013325	ABM	1.0 ug DNA	EUR 354

IFNA4 ORF Vector (Human) (pORF)
ORF013326	ABM	1.0 ug DNA	EUR 354

Ifna4 ORF Vector (Mouse) (pORF)
ORF047688	ABM	1.0 ug DNA	EUR 506

Recombinant Interferon Alpha 4 (IFNa4)
4-RPA175Hu01	Cloud-Clone	EUR 592.80 EUR 262.00 EUR 1948.00 EUR 716.00 EUR 1332.00 EUR 460.00 EUR 4720.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P05014 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Interferon Alpha 4 expressed in: E.coli

Recombinant Interferon Alpha 4 (IFNa4)
4-RPA175Mu01	Cloud-Clone	EUR 583.84 EUR 259.00 EUR 1914.40 EUR 704.80 EUR 1309.60 EUR 454.00 EUR 4636.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P07351 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20.2kDa Isoelectric Point: 7.8
Description: Recombinant Mouse Interferon Alpha 4 expressed in: E.coli

Recombinant Interferon Alpha 4 (IFNa4)
4-RPA175Ra01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D3ZFH0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 21.9kDa Isoelectric Point: 8.4
Description: Recombinant Rat Interferon Alpha 4 expressed in: E.coli

Human Interferon Alpha 4 (IFNa4) Protein
20-abx067331	Abbexa	EUR 815.00 EUR 314.00 EUR 2611.00 EUR 982.00 EUR 578.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Interferon Alpha 4 (IFNa4) Protein
20-abx067332	Abbexa	EUR 815.00 EUR 314.00 EUR 2569.00 EUR 968.00 EUR 565.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Interferon Alpha 4 (IFNa4) Protein
20-abx067333	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ifna4 sgRNA CRISPR Lentivector set (Rat)
K6039901	ABM	3 x 1.0 ug	EUR 339

Ifna4 sgRNA CRISPR Lentivector set (Mouse)
K4011601	ABM	3 x 1.0 ug	EUR 339

IFNA4 sgRNA CRISPR Lentivector set (Human)
K1019201	ABM	3 x 1.0 ug	EUR 339

Human Interferon Alpha 4 (IFNa4) CLIA Kit
20-abx190222	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Interferon Alpha 4 (IFNa4) ELISA Kit
20-abx152003	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Interferon alpha- 4, Ifna4 ELISA KIT
ELI-42256m	Lifescience Market	96 Tests	EUR 865

IFNA4 Rabbit Polyclonal Antibody