IFNA4 Rabbit Polyclonal Antibody
IFNA4 Polyclonal Antibody |
ABP58887-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human IFNA4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of IFNA4 from Human. This IFNA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFNA4 protein |
IFNA4 Polyclonal Antibody |
ABP58887-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human IFNA4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of IFNA4 from Human. This IFNA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFNA4 protein |
IFNA4 Polyclonal Antibody |
ES10706-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IFNA4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IFNA4 Polyclonal Antibody |
ES10706-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IFNA4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Interferon Alpha 4 (IFNa4) ELISA Kit |
DLR-IFNa4-Hu-48T |
DL Develop |
48T |
EUR 425 |
- Should the Human Interferon Alpha 4 (IFNa4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Alpha 4 (IFNa4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Interferon Alpha 4 (IFNa4) ELISA Kit |
DLR-IFNa4-Hu-96T |
DL Develop |
96T |
EUR 548 |
- Should the Human Interferon Alpha 4 (IFNa4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Alpha 4 (IFNa4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Interferon Alpha 4 (IFNa4) ELISA Kit |
RDR-IFNa4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 436 |
Human Interferon Alpha 4 (IFNa4) ELISA Kit |
RDR-IFNa4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 601 |
Human Interferon Alpha 4 (IFNa4) ELISA Kit |
RD-IFNa4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 418 |
Human Interferon Alpha 4 (IFNa4) ELISA Kit |
RD-IFNa4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 575 |
IFNA4 Rabbit pAb |
A8124-100ul |
Abclonal |
100 ul |
EUR 308 |
IFNA4 Rabbit pAb |
A8124-200ul |
Abclonal |
200 ul |
EUR 459 |
IFNA4 Rabbit pAb |
A8124-20ul |
Abclonal |
20 ul |
EUR 183 |
IFNA4 Rabbit pAb |
A8124-50ul |
Abclonal |
50 ul |
EUR 223 |
IFNA4 Antibody |
44812-100ul |
SAB |
100ul |
EUR 252 |
IFNA4 Antibody |
44812-50ul |
SAB |
50ul |
EUR 187 |
IFNA4 Antibody |
DF2515 |
Affbiotech |
200ul |
EUR 304 |
Description: IFNA4 antibody detects endogenous levels of total IFNA4. |
IFNA4 Antibody |
1-CSB-PA011040ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
IFNA4 Antibody |
1-CSB-PA011040LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200 |
IFNA4 Polyclonal Antibody, HRP Conjugated |
A56960 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
IFNA4 Polyclonal Antibody, FITC Conjugated |
A56961 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
IFNA4 Polyclonal Antibody, Biotin Conjugated |
A56962 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
IFNA4 Conjugated Antibody |
C44812 |
SAB |
100ul |
EUR 397 |
Anti-IFNA4 antibody |
STJ191864 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to IFNA4 |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human) |
4-PAA175Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Ala10~Ala163)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4) |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat) |
4-PAA175Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Arg33~Lys189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4) |
IFNA4 siRNA |
20-abx920226 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IFNA4 siRNA |
20-abx920227 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-IFNA4 |
YF-PA12567 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to IFNA4 |
anti-IFNA4 |
YF-PA12568 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to IFNA4 |
anti-IFNA4 |
YF-PA12569 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to IFNA4 |
IFNA4 Antibody, HRP conjugated |
1-CSB-PA011040LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
IFNA4 Antibody, FITC conjugated |
1-CSB-PA011040LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
IFNA4 Antibody, Biotin conjugated |
1-CSB-PA011040LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), APC |
4-PAA175Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Ala10~Ala163)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with APC. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), Biotinylated |
4-PAA175Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Ala10~Ala163)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with Biotin. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), Cy3 |
4-PAA175Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Ala10~Ala163)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with Cy3. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), FITC |
4-PAA175Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Ala10~Ala163)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with FITC. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), HRP |
4-PAA175Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Ala10~Ala163)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with HRP. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), PE |
4-PAA175Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Ala10~Ala163)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with PE. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat) |
4-PAA175Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Asp26~Glu186)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4) |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), APC |
4-PAA175Ra01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Arg33~Lys189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with APC. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), Biotinylated |
4-PAA175Ra01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Arg33~Lys189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with Biotin. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), Cy3 |
4-PAA175Ra01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Arg33~Lys189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with Cy3. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), FITC |
4-PAA175Ra01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Arg33~Lys189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with FITC. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), HRP |
4-PAA175Ra01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Arg33~Lys189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with HRP. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), PE |
4-PAA175Ra01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Arg33~Lys189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with PE. |
IFNA4 Blocking Peptide |
DF2515-BP |
Affbiotech |
1mg |
EUR 195 |
IFNA4 cloning plasmid |
CSB-CL011040HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 570
- Sequence: atggccctgtccttttctttactgatggccgtgctggtgctcagctacaaatccatctgttctctgggctgtgatctgcctcagacccacagcctgggtaataggagggccttgatactcctggcacaaatgggaagaatctctcatttctcctgcctgaaggacagacatgattt
- Show more
|
Description: A cloning plasmid for the IFNA4 gene. |
IFNA4 cloning plasmid |
CSB-CL011040HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 570
- Sequence: atggccctgtccttttctttactgatggccgtgctggtgctcagctacaaatccatctgttctctgggctgtgatctgcctcagacccacagcctgggtaataggagggccttgatactcctggcacaaatgggaagaatctctcatttctcctgcctgaaggacagacatgattt
- Show more
|
Description: A cloning plasmid for the IFNA4 gene. |
Interferon Alpha 4 (IFNA4) Antibody |
20-abx216154 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Interferon Alpha 4 (IFNa4) Antibody |
20-abx101877 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Interferon Alpha 4 (IFNa4) Antibody |
20-abx101878 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Interferon Alpha 4 (IFNa4) Antibody |
20-abx101879 |
Abbexa |
-
EUR 300.00
-
EUR 133.00
-
EUR 801.00
-
EUR 425.00
-
EUR 258.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Interferon Alpha 4 (IFNa4) Antibody |
20-abx172993 |
Abbexa |
|
|
|
Interferon Alpha 4 (IFNA4) Antibody |
abx034855-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Interferon Alpha 4 (IFNA4) Antibody |
abx034855-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Interferon Alpha 4 (IFNA4) Antibody |
20-abx320564 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Interferon Alpha 4 (IFNA4) Antibody |
20-abx317914 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA175Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Ala10~Ala163)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with APC-Cy7. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), APC |
4-PAA175Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Asp26~Glu186)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with APC. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), Biotinylated |
4-PAA175Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Asp26~Glu186)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with Biotin. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), Cy3 |
4-PAA175Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Asp26~Glu186)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with Cy3. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), FITC |
4-PAA175Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Asp26~Glu186)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with FITC. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), HRP |
4-PAA175Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Asp26~Glu186)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with HRP. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), PE |
4-PAA175Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Asp26~Glu186)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with PE. |
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAA175Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Arg33~Lys189)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with APC-Cy7. |
Interferon Alpha 4 (IFNa4) Antibody (Biotin) |
20-abx273015 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Interferon Alpha 4 (IFNA4) Antibody (HRP) |
20-abx304208 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Interferon Alpha 4 (IFNA4) Antibody (FITC) |
20-abx304209 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Interferon Alpha 4 (IFNA4) Antibody (Biotin) |
20-abx304210 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), APC-Cy7 |
4-PAA175Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IFNa4 (Asp26~Glu186)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with APC-Cy7. |
Human IFNA4 shRNA Plasmid |
20-abx952330 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse IFNA4 shRNA Plasmid |
20-abx970976 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Interferon alpha-4 (IFNA4) |
1-CSB-EP011040HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 35.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Interferon alpha-4(IFNA4),partial expressed in E.coli |
Ifna4 ORF Vector (Rat) (pORF) |
ORF068514 |
ABM |
1.0 ug DNA |
EUR 506 |
IFNA4 ORF Vector (Human) (pORF) |
ORF013325 |
ABM |
1.0 ug DNA |
EUR 354 |
IFNA4 ORF Vector (Human) (pORF) |
ORF013326 |
ABM |
1.0 ug DNA |
EUR 354 |
Ifna4 ORF Vector (Mouse) (pORF) |
ORF047688 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Interferon Alpha 4 (IFNa4) |
4-RPA175Hu01 |
Cloud-Clone |
-
EUR 592.80
-
EUR 262.00
-
EUR 1948.00
-
EUR 716.00
-
EUR 1332.00
-
EUR 460.00
-
EUR 4720.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P05014
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Interferon Alpha 4 expressed in: E.coli |
Recombinant Interferon Alpha 4 (IFNa4) |
4-RPA175Mu01 |
Cloud-Clone |
-
EUR 583.84
-
EUR 259.00
-
EUR 1914.40
-
EUR 704.80
-
EUR 1309.60
-
EUR 454.00
-
EUR 4636.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P07351
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 20.2kDa
- Isoelectric Point: 7.8
|
Description: Recombinant Mouse Interferon Alpha 4 expressed in: E.coli |
Recombinant Interferon Alpha 4 (IFNa4) |
4-RPA175Ra01 |
Cloud-Clone |
-
EUR 512.16
-
EUR 240.00
-
EUR 1645.60
-
EUR 615.20
-
EUR 1130.40
-
EUR 406.00
-
EUR 3964.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: D3ZFH0
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 21.9kDa
- Isoelectric Point: 8.4
|
Description: Recombinant Rat Interferon Alpha 4 expressed in: E.coli |
Human Interferon Alpha 4 (IFNa4) Protein |
20-abx067331 |
Abbexa |
-
EUR 815.00
-
EUR 314.00
-
EUR 2611.00
-
EUR 982.00
-
EUR 578.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Mouse Interferon Alpha 4 (IFNa4) Protein |
20-abx067332 |
Abbexa |
-
EUR 815.00
-
EUR 314.00
-
EUR 2569.00
-
EUR 968.00
-
EUR 565.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Interferon Alpha 4 (IFNa4) Protein |
20-abx067333 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2221.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Ifna4 sgRNA CRISPR Lentivector set (Rat) |
K6039901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ifna4 sgRNA CRISPR Lentivector set (Mouse) |
K4011601 |
ABM |
3 x 1.0 ug |
EUR 339 |
IFNA4 sgRNA CRISPR Lentivector set (Human) |
K1019201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Interferon Alpha 4 (IFNa4) CLIA Kit |
20-abx190222 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Interferon Alpha 4 (IFNa4) ELISA Kit |
20-abx152003 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
IFNA4 Rabbit Polyclonal Antibody