IGF2 Rabbit Polyclonal Antibody

IGF2 Rabbit Polyclonal Antibody

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RDR-IGF2-Rb-96Tests	Reddot Biotech	96 Tests	EUR 651

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RD-IGF2-Rb-48Tests	Reddot Biotech	48 Tests	EUR 450

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RD-IGF2-Rb-96Tests	Reddot Biotech	96 Tests	EUR 622

IGF2 Polyclonal Antibody
ABP58900-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human IGF2 protein Applications tips:
Description: A polyclonal antibody for detection of IGF2 from Human, Mouse, Rat. This IGF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGF2 protein

IGF2 Polyclonal Antibody
ABP58900-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human IGF2 protein Applications tips:
Description: A polyclonal antibody for detection of IGF2 from Human, Mouse, Rat. This IGF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGF2 protein

IGF2 Polyclonal Antibody
ABP58900-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human IGF2 protein Applications tips:
Description: A polyclonal antibody for detection of IGF2 from Human, Mouse, Rat. This IGF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGF2 protein

IGF2 Polyclonal Antibody
ES10707-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IGF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

IGF2 Polyclonal Antibody
ES10707-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IGF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

IGF2 Rabbit pAb
A14005-100ul	Abclonal	100 ul	EUR 308

IGF2 Rabbit pAb
A14005-200ul	Abclonal	200 ul	EUR 459

IGF2 Rabbit pAb
A14005-20ul	Abclonal	20 ul	EUR 183

IGF2 Rabbit pAb
A14005-50ul	Abclonal	50 ul	EUR 223

IGF2 Rabbit pAb
A2086-100ul	Abclonal	100 ul	EUR 308

IGF2 Rabbit pAb
A2086-200ul	Abclonal	200 ul	EUR 459

IGF2 Rabbit pAb
A2086-20ul	Abclonal	20 ul	EUR 183

IGF2 Rabbit pAb
A2086-50ul	Abclonal	50 ul	EUR 223

IGF2-BP2 Polyclonal Antibody
ABP53530-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190 Applications tips:
Description: A polyclonal antibody for detection of IGF2-BP2 from Human. This IGF2-BP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190

IGF2-BP2 Polyclonal Antibody
ABP53530-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190 Applications tips:
Description: A polyclonal antibody for detection of IGF2-BP2 from Human. This IGF2-BP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190

IGF2-BP2 Polyclonal Antibody
ABP53530-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190 Applications tips:
Description: A polyclonal antibody for detection of IGF2-BP2 from Human. This IGF2-BP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190

IGF2-BP2 Polyclonal Antibody
ES4529-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IGF2-BP2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

IGF2-BP2 Polyclonal Antibody
ES4529-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IGF2-BP2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal IGF2 Antibody (Center R54)
APR03540G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF2 (Center R54). This antibody is tested and proven to work in the following applications:

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit
DLR-IGF2-b-48T	DL Develop	48T	EUR 493
Should the Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit
DLR-IGF2-b-96T	DL Develop	96T	EUR 641
Should the Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit
DLR-IGF2-Hu-48T	DL Develop	48T	EUR 425
Should the Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit
DLR-IGF2-Hu-96T	DL Develop	96T	EUR 548
Should the Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit
DLR-IGF2-Mu-48T	DL Develop	48T	EUR 435
Should the Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit
DLR-IGF2-Mu-96T	DL Develop	96T	EUR 561
Should the Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit
DLR-IGF2-p-48T	DL Develop	48T	EUR 493
Should the Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit
DLR-IGF2-p-96T	DL Develop	96T	EUR 641
Should the Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit
DLR-IGF2-Ra-48T	DL Develop	48T	EUR 454
Should the Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit
DLR-IGF2-Ra-96T	DL Develop	96T	EUR 587
Should the Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RDR-IGF2-b-48Tests	Reddot Biotech	48 Tests	EUR 516

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RDR-IGF2-b-96Tests	Reddot Biotech	96 Tests	EUR 716

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RDR-IGF2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RDR-IGF2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RDR-IGF2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 447

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RDR-IGF2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 618

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RDR-IGF2-p-48Tests	Reddot Biotech	48 Tests	EUR 516

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RDR-IGF2-p-96Tests	Reddot Biotech	96 Tests	EUR 716

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RDR-IGF2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 470

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RDR-IGF2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 651

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RD-IGF2-b-48Tests	Reddot Biotech	48 Tests	EUR 494

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RD-IGF2-b-96Tests	Reddot Biotech	96 Tests	EUR 684

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RD-IGF2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 418

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RD-IGF2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 575

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RD-IGF2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 429

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RD-IGF2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 591

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RD-IGF2-p-48Tests	Reddot Biotech	48 Tests	EUR 494

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RD-IGF2-p-96Tests	Reddot Biotech	96 Tests	EUR 684

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RD-IGF2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 450

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit
RD-IGF2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 622

IGF2 antibody
70R-12270	Fitzgerald	100 ug	EUR 460
Description: Rabbit polyclonal IGF2 antibody

IGF2 antibody
70-IR16	Fitzgerald	50 ug	EUR 327
Description: Affinity purified Rabbit polyclonal IGF2 antibody

IGF2 Antibody
32592-100ul	SAB	100ul	EUR 252

IGF2 antibody
10R-I135a	Fitzgerald	100 ug	EUR 555
Description: Mouse monoclonal IGF2 antibody

IGF2 Antibody
49302-100ul	SAB	100ul	EUR 333

IGF2 Antibody
49302-50ul	SAB	50ul	EUR 239

IGF2 Antibody
DF6810	Affbiotech	200ul	EUR 304
Description: IGF2 Antibody detects endogenous levels of total IGF2.

IGF2 Antibody
DF2516	Affbiotech	200ul	EUR 304
Description: IGF2 antibody detects endogenous levels of total IGF2.

IGF2 Antibody
BF0039	Affbiotech	200ul	EUR 376
Description: IGF2 antibody detects endogenous levels of total IGF2.

IGF2 Antibody
CSB-PA011088KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IGF2. Recognizes IGF2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

IGF2 Antibody
CSB-PA011088KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IGF2. Recognizes IGF2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

IGF2 Antibody
ABD2516	Lifescience Market	100 ug	EUR 438

IGF2 Antibody
ABD6810	Lifescience Market	100 ug	EUR 438

IGF2 ELISA Kit (Rabbit) (OKCD01445)
OKCD01445	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Broad specificity oxidoreductase that catalyzes the NADPH-dependent reduction of a variety of flavins, such as riboflavin, FAD or FMN, biliverdins, methemoglobin and PQQ (pyrroloquinoline quinone). Contributes to heme catabolism and metabolizes linear tetrapyrroles. Can also reduce the complexed Fe3+ iron to Fe2+ in the presence of FMN and NADPH. In the liver, converts biliverdin to bilirubin.;Species reactivity: Rabbit;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.8 ng/mL

IGF2 ELISA Kit (Rabbit) (OKBB00711)
OKBB00711	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Insulin-like growth factor II is also known as somatomedin A. IGF-2 is a member of the insulin family of polypeptide growth factors that is involved in development and growth. It is paternally expressed in the fetus and placenta. IGF-II is a mitogen for many cell types and an important modulator of muscle growth and differentiation. IGF-II gene is prevalently expressed during prenatal development and its gene activity is regulated by genomic imprinting, in that the allele inherited from the father is active and the allele inherited from the mother is inactive in most normal tissues. IGF-II appears to be induced by placental lactogen during prenatal development. It is a mediator of prolactin-induced alveologenesis; prolactin, IGF-2, and cyclin D1, all of which are overexpressed in breast cancers, are components of a developmental pathway in the mammary gland. The rabbit IGF-II gene is located on chromosome 11. The standard product used in this kit is recombinant rabbit IGF-2, consisting of 67 amino acids in mature form with the molecular mass of 7.5KDa. IGF-1 and IGF-2 share high homology.;Species reactivity: Rabbit;Application: ELISA;Assay info: ;Sensitivity: <2pg/ml

IGF2
E21-F61	EnoGene	10ug	EUR 343

IGF2
LF-PR027	Abfrontier	50 ug	EUR 177
Description: IGF2 protein

Anti-IGF2/Igf Ii Rabbit Monoclonal Antibody
M00335	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal IGF2/Igf Ii Antibody. Validated in IF, WB and tested in Human.

IGF2 Conjugated Antibody
C49302	SAB	100ul	EUR 397

Anti-IGF2 antibody
STJ24139	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-IGF2 antibody
STJ115940	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-IGF2 antibody
STJ191865	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to IGF2

Polyclonal IGF2 (aa81-93) Antibody (internal region)
APG00772G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IGF2 (aa81-93) (internal region). This antibody is tested and proven to work in the following applications:

IGF2 protein
30R-1836	Fitzgerald	50 ug	EUR 397
Description: Purified recombinant Human IGF2 protein

IGF2 protein
30-AI89	Fitzgerald	50 ug	EUR 298
Description: Purified recombinant Human IGF2 protein

anti-IGF2
YF-PA12620	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to IGF2

anti-IGF2
YF-PA12621	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to IGF2

Anti-IGF2-BP2 antibody
STJ93649	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to IGF2-BP2.

Rabbit Anti-Human IGF2 monoclonal antibody, clone KK103-4
CAB-242RH	Creative Diagnostics	100 ul	EUR 777

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine)
4-PAA051Bo01	Cloud-Clone	EUR 259.00 EUR 2694.00 EUR 667.00 EUR 326.00 EUR 218.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2)

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Human)
4-PAA051Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 (IGF2)

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Mouse)
4-PAA051Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 (IGF2)

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Rat)
4-PAA051Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Insulin Like Growth Factor 2 (IGF2)

Monoclonal IGF2 Antibody, Clone: 8H1
APR07954G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human IGF2. The antibodies are raised in Mouse and are from clone 8H1. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal IGF2 Antibody, Clone: 519CT14.3.6
AMM02414G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human IGF2. The antibodies are raised in Mouse and are from clone 519CT14.3.6. This antibody is applicable in WB, E

Anti-IGF2 (aa81-93) antibody
STJ72637	St John's Laboratory	100 µg	EUR 359

IGF2 Blocking Peptide
DF6810-BP	Affbiotech	1mg	EUR 195

IGF2 Blocking Peptide
DF2516-BP	Affbiotech	1mg	EUR 195

IGF2 Blocking Peptide
BF0039-BP	Affbiotech	1mg	EUR 195

INS-IGF2 siRNA
20-abx920668	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IGF2 cloning plasmid
CSB-CL011088HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 543 Sequence: atgggaatcccaatggggaagtcgatgctggtgcttctcaccttcttggccttcgcctcgtgctgcattgctgcttaccgccccagtgagaccctgtgcggcggggagctggtggacaccctccagttcgtctgtggggaccgcggcttctacttcagcaggcccgcaagccgtgt Show more
Description: A cloning plasmid for the IGF2 gene.

IGF2 cloning plasmid
CSB-CL011088HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 342 Sequence: atgaccccgggggtcgtccatgccagtccgcctcagtcgcagagggtccctcggcaagcgccctgtgagtgggccattcggaacattggacagaagcccaaagagccaaattgtcacaattgtggaacccacattggcctgagatccaaaacgcttcgaggcaccccaaattacct Show more
Description: A cloning plasmid for the IGF2 gene.

anti-IGF2 (8H1)
LF-MA30762	Abfrontier	100 ul	EUR 527
Description: Mouse Monoclonal to IGF2

pENTR223-IGF2 vector
PVT11853	Lifescience Market	2 ug	EUR 304

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine), APC
4-PAA051Bo01-APC	Cloud-Clone	EUR 363.00 EUR 3527.00 EUR 975.00 EUR 465.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with APC.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine), Biotinylated
4-PAA051Bo01-Biotin	Cloud-Clone	EUR 324.00 EUR 2644.00 EUR 773.00 EUR 399.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with Biotin.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine), Cy3
4-PAA051Bo01-Cy3	Cloud-Clone	EUR 443.00 EUR 4661.00 EUR 1259.00 EUR 578.00 EUR 260.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with Cy3.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine), FITC
4-PAA051Bo01-FITC	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with FITC.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine), HRP
4-PAA051Bo01-HRP	Cloud-Clone	EUR 331.00 EUR 3073.00 EUR 862.00 EUR 419.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with HRP.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine), PE
4-PAA051Bo01-PE	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with PE.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Human), APC
4-PAA051Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with APC.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Human), Biotinylated
4-PAA051Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with Biotin.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Human), Cy3
4-PAA051Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with Cy3.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Human), FITC
4-PAA051Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with FITC.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Human), HRP
4-PAA051Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with HRP.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Human), PE
4-PAA051Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with PE.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Mouse), APC
4-PAA051Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with APC.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Mouse), Biotinylated
4-PAA051Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with Biotin.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Mouse), Cy3
4-PAA051Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with Cy3.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Mouse), FITC
4-PAA051Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with FITC.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Mouse), HRP
4-PAA051Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with HRP.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Mouse), PE
4-PAA051Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with PE.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Rat), APC
4-PAA051Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with APC.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Rat), Biotinylated
4-PAA051Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with Biotin.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Rat), Cy3
4-PAA051Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with Cy3.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Rat), FITC
4-PAA051Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with FITC.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Rat), HRP
4-PAA051Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with HRP.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Rat), PE
4-PAA051Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with PE.

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit
20-abx155066	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit
abx257020-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rabbit Insulin-like growth factor II (IGF2) ELISA Kit
abx354261-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Insulin Like Growth Factor 2 (IGF2) CLIA Kit
20-abx490823	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit
SEA051Rb-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Insulin Like Growth Factor 2 (IGF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit Insulin Like Growth Factor 2 (IGF2) in serum, plasma and other biological fluids.

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit
SEA051Rb-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Insulin Like Growth Factor 2 (IGF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit Insulin Like Growth Factor 2 (IGF2) in serum, plasma and other biological fluids.

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit
SEA051Rb-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Insulin Like Growth Factor 2 (IGF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit Insulin Like Growth Factor 2 (IGF2) in serum, plasma and other biological fluids.

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit
SEA051Rb-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Insulin Like Growth Factor 2 (IGF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rabbit Insulin Like Growth Factor 2 (IGF2) in serum, plasma and other biological fluids.

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit
4-SEA051Rb	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Insulin Like Growth Factor 2 elisa. Alternative names of the recognized antigen: INSIGF IGF-II Somatomedin A Preptin Insulin-like growth factor II Ala-25 Del
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rabbit Insulin Like Growth Factor 2 (IGF2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat IGF2 ELISA Kit
55R-1596	Fitzgerald	1 kit	EUR 624
Description: ELISA kit for detection of IGF2 in the research laboratory

Mouse IGF2 ELISA Kit
55R-1597	Fitzgerald	1 kit	EUR 624
Description: ELISA kit for detection of IGF2 in the research laboratory

Human IGF2 ELISA Kit
ELA-E0051h	Lifescience Market	96 Tests	EUR 824

Rat IGF2 shRNA Plasmid
20-abx984511	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human IGF2 shRNA Plasmid
20-abx952352	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse IGF2 shRNA Plasmid
20-abx970987	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Human IGF2 Protein
RP00388	Abclonal	10 μg	EUR 174

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine), APC-Cy7
4-PAA051Bo01-APC-Cy7	Cloud-Clone	EUR 607.00 EUR 6934.00 EUR 1831.00 EUR 810.00 EUR 333.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with APC-Cy7.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Human), APC-Cy7
4-PAA051Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with APC-Cy7.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA051Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with APC-Cy7.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Rat), APC-Cy7
4-PAA051Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IGF2 (Ala25~Glu91) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with APC-Cy7.

ELISA kit for Rabbit IGF2 (Insulin Like Growth Factor 2)
ELK2441	ELK Biotech	1 plate of 96 wells	EUR 526
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Insulin Like Growth Factor 2 (IGF2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t Show more
Description: A sandwich ELISA kit for detection of Insulin Like Growth Factor 2 from Rabbit in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Insulin-Like Growth Factor II (IGF2) Antibody
abx025445-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx176963	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx176964	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx176965	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx176966	Abbexa	EUR 1288.00 EUR 620.00	1 mg 200 ug
Please enquire.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx176967	Abbexa	EUR 1316.00 EUR 634.00	1 mg 200 ug
Please enquire.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx176968	Abbexa	EUR 1316.00 EUR 634.00	1 mg 200 ug
Please enquire.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx102887	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx102888	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx102889	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Insulin Like Growth Factor 2 (IGF2) Antibody
abx117200-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx129983	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx132181	Abbexa	EUR 453.00 EUR 133.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx172915	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx172916	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx172917	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx172918	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Insulin Like Growth Factor 2 (IGF2) Antibody
20-abx172919	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Insulin-Like Growth Factor II (IGF2) Antibody
abx012013-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Insulin-Like Growth Factor II (IGF2) Antibody
abx412541-01mg	Abbexa	0.1 mg	EUR 704
Shipped within 1 week.

Insulin Like Growth Factor 2 (IGF2) Antibody
abx431352-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Insulin-Like Growth Factor II (IGF2) Antibody
20-abx225233	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Insulin-Like Growth Factor II (IGF2) Antibody
20-abx000056	Abbexa	EUR 495.00 EUR 356.00	100 ul 50 ul
Shipped within 5-10 working days.

Insulin-Like Growth Factor II (IGF2) Antibody
20-abx001698	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Human INS-IGF2 shRNA Plasmid
20-abx968617	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Igf2 ORF Vector (Rat) (pORF)
ORF068541	ABM	1.0 ug DNA	EUR 506

Igf2 ORF Vector (Rat) (pORF)
ORF068542	ABM	1.0 ug DNA	EUR 506

Igf2 ORF Vector (Rat) (pORF)
ORF068543	ABM	1.0 ug DNA	EUR 506

IGF2 ORF Vector (Human) (pORF)
ORF005230	ABM	1.0 ug DNA	EUR 95

IGF2 ORF Vector (Human) (pORF)
ORF005231	ABM	1.0 ug DNA	EUR 95

Igf2 ORF Vector (Mouse) (pORF)
ORF047729	ABM	1.0 ug DNA	EUR 506

Igf2 ORF Vector (Mouse) (pORF)
ORF047730	ABM	1.0 ug DNA	EUR 506

Igf2 ORF Vector (Mouse) (pORF)
ORF047731	ABM	1.0 ug DNA	EUR 506

IGF2 ELISA Kit (Human) (OKAN05178)
OKAN05178	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.264 ng/mL

IGF2 ELISA Kit (Porcine) (OKAN05967)
OKAN05967	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Porcine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.59 ng/mL

IGF2 ELISA Kit (Pig) (OKCD02614)
OKCD02614	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: The insulin-like growth factors possess growth-promoting activity. In vitro, they are potent mitogens for cultured cells. IGF-II is influenced by placental lactogen and may play a role in fetal development. Preptin undergoes glucose-mediated co-secretion with insulin, and acts as physiological amplifier of glucose-mediated insulin secretion. Exhibits osteogenic properties by increasing osteoblast mitogenic activity through phosphoactivation of MAPK1 and MAPK3. ;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.59 ng/mL

IGF2 ELISA Kit (Monkey) (OKBB00710)
OKBB00710	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Insulin-like growth factor II is also known as somatomedin A. IGF-2 is a member of the insulin family of polypeptide growth factors that is involved in development and growth. It is paternally expressed in the fetus and placenta. IGF-II is a mitogen for many cell types and an important modulator of muscle growth and differentiation. IGF-II gene is prevalently expressed during prenatal development and its gene activity is regulated by genomic imprinting, in that the allele inherited from the father is active and the allele inherited from the mother is inactive in most normal tissues. IGF-II appears to be induced by placental lactogen during prenatal development. It is a mediator of prolactin-induced alveologenesis; prolactin, IGF-2, and cyclin D1, all of which are overexpressed in breast cancers, are components of a developmental pathway in the mammary gland. The monkey primate IGF-II gene is located on chromosome 11. The standard product used in this kit is recombinant monkey primate IGF-2, consisting of 67 amino acids in mature form with the molecular mass of 7.5KDa. IGF-1 and IGF-2 share high homology.;Species reactivity: Monkey;Application: ELISA;Assay info: ;Sensitivity: <2pg/ml

Igf2 ELISA Kit (Hamster) (OKBB00712)
OKBB00712	Aviva Systems Biology	96 Wells	EUR 544
Description: Description of target: Insulin-like growth factor II is also known as somatomedin A. IGF-2 is a member of the insulin family of polypeptide growth factors that is involved in development and growth. It is paternally expressed in the fetus and placenta. IGF-II is a mitogen for many cell types and an important modulator of muscle growth and differentiation. IGF-II gene is prevalently expressed during prenatal development and its gene activity is regulated by genomic imprinting, in that the allele inherited from the father is active and the allele inherited from the mother is inactive in most normal tissues. IGF-II appears to be induced by placental lactogen during prenatal development. It is a mediator of prolactin-induced alveologenesis; prolactin, IGF-2, and cyclin D1, all of which are overexpressed in breast cancers, are components of a developmental pathway in the mammary gland.;Species reactivity: Hamster;Application: ELISA;Assay info: ;Sensitivity: <5pg/ml

IGF2 ELISA Kit (Dog) (OKCA01044)
OKCA01044	Aviva Systems Biology	96 Wells	EUR 930
Description: Description of target: The insulin-like growth factors possess growth-promoting activity. In vitro, they are potent mitogens for cultured cells. IGF-II is influenced by placental lactogen and may play a role in fetal development. Preptin undergoes glucose-mediated co-secretion with insulin, and acts as physiological amplifier of glucose-mediated insulin secretion. Exhibits osteogenic properties by increasing osteoblast mitogenic activity through phosphoactivation of MAPK1 and MAPK3.;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

IGF2 ELISA Kit (Fish) (OKCA01046)
OKCA01046	Aviva Systems Biology	96 Wells	EUR 930
Description: Description of target: The insulin-like growth factors possess growth-promoting activity. In vitro, they are potent mitogens for cultured cells. IGF-II is influenced by placental lactogen and may play a role in fetal development. Preptin undergoes glucose-mediated co-secretion with insulin, and acts as physiological amplifier of glucose-mediated insulin secretion. Exhibits osteogenic properties by increasing osteoblast mitogenic activity through phosphoactivation of MAPK1 and MAPK3.;Species reactivity: Fish;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 31.25 pg/mL

IGF2 ELISA Kit (Bovine) (OKCD05751)
OKCD05751	Aviva Systems Biology	96 Wells	EUR 1040
Description: Description of target: The insulin-like growth factors possess growth-promoting activity. In vitro, they are potent mitogens for cultured cells. IGF-II is influenced by placental lactogen and may play a role in fetal development.Preptin undergoes glucose-mediated co-secretion with insulin, and acts as physiological amplifier of glucose-mediated insulin secretion. Exhibits osteogenic properties by increasing osteoblast mitogenic activity through phosphoactivation of MAPK1 and MAPK3 ;Species reactivity: Bovine;Application: ELISA;Assay info: ;Sensitivity: < 0.277ng/mL

IGF2 ELISA Kit (Human) (OKCD05752)
OKCD05752	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.264ng/mL

IGF2 ELISA Kit (Mouse) (OKCD05753)
OKCD05753	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. It is an imprinted gene that is expressed only from the paternal allele. The encoded protein undergoes proteolytic processing to generate a mature peptide. The transgenic overexpression of this gene in mice results in prenatal overgrowth, polyhydramnios, fetal and neonatal lethality, disproportionate organ overgrowth including tongue enlargement, and skeletal abnormalities. Mice lacking the encoded protein exhibit growth deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.8pg/mL

IGF2 ELISA Kit (Rat) (OKCD05754)
OKCD05754	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: a mitogenic growth factor; may have a role in fetal development.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 30pg/mL

IGF2 ELISA Kit (Chicken) (OKEH07250)
OKEH07250	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

IGF2 ELISA Kit (Pig) (OKEH07251)
OKEH07251	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.062ng/mL

IGF2 ELISA Kit (Bovine) (OKEH03806)
OKEH03806	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: The insulin-like growth factors possess growth-promoting activity. In vitro, they are potent mitogens for cultured cells. IGF-II is influenced by placental lactogen and may play a role in fetal development._x000D_Preptin undergoes glucose-mediated co-secretion with insulin, and acts as physiological amplifier of glucose-mediated insulin secretion. Exhibits osteogenic properties by increasing osteoblast mitogenic activity through phosphoactivation of MAPK1 and MAPK3 ;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.05 ng/mL

IGF2 ELISA Kit (Rat) (OKEH04126)
OKEH04126	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: a mitogenic growth factor; may have a role in fetal development [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.66 pg/mL

Insulin Like Growth Factor 2 (IGF2) Antibody (Biotin)
20-abx271902	Abbexa	EUR 425.00 EUR 230.00 EUR 1191.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Insulin Like Growth Factor 2 (IGF2) Antibody (Biotin)
20-abx272645	Abbexa	EUR 425.00 EUR 230.00 EUR 1219.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Insulin Like Growth Factor 2 (IGF2) Antibody (Biotin)
20-abx273130	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Insulin Like Growth Factor 2 (IGF2) Antibody (FITC)
20-abx273858	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Insulin Like Growth Factor 2 (IGF2) Antibody (FITC)
20-abx274043	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Insulin Like Growth Factor 2 (IGF2) Antibody (FITC)
20-abx274172	Abbexa	EUR 467.00 EUR 244.00 EUR 1386.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Anti-IGF2 (Dusigitumab)-SMCC-DM1 ADC
ADC-W-1268	Creative Biolabs	1mg	Ask for price
Description: This ADC product is comprised of an anti-IGF2 monoclonal antibody conjugated via a SMCC linker to DM1

Anti-IGF2 (Dusigitumab)-SPDB-DM4 ADC
ADC-W-1269	Creative Biolabs	1mg	Ask for price
Description: This ADC product is comprised of an anti-IGF2 monoclonal antibody conjugated via a SPDB linker to DM4

Anti-IGF2 (Dusigitumab)-MC-MMAF ADC
ADC-W-1270	Creative Biolabs	1mg	Ask for price
Description: This ADC product is comprised of an anti-IGF2 monoclonal antibody conjugated via a MC linker to MMAF

Igf2 sgRNA CRISPR Lentivector set (Mouse)
K5027701	ABM	3 x 1.0 ug	EUR 339

Igf2 sgRNA CRISPR Lentivector set (Rat)
K7618401	ABM	3 x 1.0 ug	EUR 339

IGF2 sgRNA CRISPR Lentivector set (Human)
K1024601	ABM	3 x 1.0 ug	EUR 339

h INS-IGF2 inducible lentiviral particles
LVP699	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: INS-IGF2 ( INS-IGF2 readthrough), [alternative names: INSIGF]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001042376.2. It also contains a RFP-Blasticidin dual selection marker.

IGF2-AS1 ORF Vector (Human) (pORF)
ORF021396	ABM	1.0 ug DNA	Ask for price

INS-IGF2 ORF Vector (Human) (pORF)
ORF021922	ABM	1.0 ug DNA	Ask for price

IGF2 ELISA Kit (Pig | Swine) (OKCA02202)
OKCA02202	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: The insulin-like growth factors possess growth-promoting activity. In vitro, they are potent mitogens for cultured cells. IGF-II is influenced by placental lactogen and may play a role in fetal development. Preptin undergoes glucose-mediated co-secretion with insulin, and acts as physiological amplifier of glucose-mediated insulin secretion. Exhibits osteogenic properties by increasing osteoblast mitogenic activity through phosphoactivation of MAPK1 and MAPK3.;Species reactivity: Pig | Swine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody
ABP57581-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG14L Rabbit Polyclonal Antibody
ABP57583-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

NBR1 Rabbit Polyclonal Antibody
ABP57585-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-02ml	Abbkine	0.2ml	EUR 414