IGF2 Rabbit Polyclonal Antibody
 ELISA Kit) Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RDR-IGF2-Rb-96Tests |
Reddot Biotech |
96 Tests |
EUR 651 |
Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RD-IGF2-Rb-48Tests |
Reddot Biotech |
48 Tests |
EUR 450 |
Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RD-IGF2-Rb-96Tests |
Reddot Biotech |
96 Tests |
EUR 622 |
 IGF2 Polyclonal Antibody |
|
ABP58900-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human IGF2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of IGF2 from Human, Mouse, Rat. This IGF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGF2 protein |
IGF2 Polyclonal Antibody |
|
ABP58900-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human IGF2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of IGF2 from Human, Mouse, Rat. This IGF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGF2 protein |
IGF2 Polyclonal Antibody |
|
ABP58900-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human IGF2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of IGF2 from Human, Mouse, Rat. This IGF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGF2 protein |
IGF2 Polyclonal Antibody |
|
ES10707-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IGF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IGF2 Polyclonal Antibody |
|
ES10707-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IGF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 IGF2 Rabbit pAb |
|
A14005-100ul |
Abclonal |
100 ul |
EUR 308 |
IGF2 Rabbit pAb |
|
A14005-200ul |
Abclonal |
200 ul |
EUR 459 |
IGF2 Rabbit pAb |
|
A14005-20ul |
Abclonal |
20 ul |
EUR 183 |
IGF2 Rabbit pAb |
|
A14005-50ul |
Abclonal |
50 ul |
EUR 223 |
IGF2 Rabbit pAb |
|
A2086-100ul |
Abclonal |
100 ul |
EUR 308 |
IGF2 Rabbit pAb |
|
A2086-200ul |
Abclonal |
200 ul |
EUR 459 |
IGF2 Rabbit pAb |
|
A2086-20ul |
Abclonal |
20 ul |
EUR 183 |
IGF2 Rabbit pAb |
|
A2086-50ul |
Abclonal |
50 ul |
EUR 223 |
 IGF2-BP2 Polyclonal Antibody |
|
ABP53530-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190
- Applications tips:
|
|
Description: A polyclonal antibody for detection of IGF2-BP2 from Human. This IGF2-BP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190 |
IGF2-BP2 Polyclonal Antibody |
|
ABP53530-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190
- Applications tips:
|
|
Description: A polyclonal antibody for detection of IGF2-BP2 from Human. This IGF2-BP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190 |
IGF2-BP2 Polyclonal Antibody |
|
ABP53530-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190
- Applications tips:
|
|
Description: A polyclonal antibody for detection of IGF2-BP2 from Human. This IGF2-BP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190 |
IGF2-BP2 Polyclonal Antibody |
|
ES4529-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IGF2-BP2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IGF2-BP2 Polyclonal Antibody |
|
ES4529-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IGF2-BP2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
) Polyclonal IGF2 Antibody (Center R54) |
|
APR03540G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF2 (Center R54). This antibody is tested and proven to work in the following applications: |
 ELISA Kit) Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
DLR-IGF2-b-48T |
DL Develop |
48T |
EUR 493 |
- Should the Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids. |
Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
DLR-IGF2-b-96T |
DL Develop |
96T |
EUR 641 |
- Should the Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids. |
 ELISA Kit) Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
DLR-IGF2-Hu-48T |
DL Develop |
48T |
EUR 425 |
- Should the Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
DLR-IGF2-Hu-96T |
DL Develop |
96T |
EUR 548 |
- Should the Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
 ELISA Kit) Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
DLR-IGF2-Mu-48T |
DL Develop |
48T |
EUR 435 |
- Should the Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids. |
Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
DLR-IGF2-Mu-96T |
DL Develop |
96T |
EUR 561 |
- Should the Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids. |
 ELISA Kit) Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
DLR-IGF2-p-48T |
DL Develop |
48T |
EUR 493 |
- Should the Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
DLR-IGF2-p-96T |
DL Develop |
96T |
EUR 641 |
- Should the Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
 ELISA Kit) Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
DLR-IGF2-Ra-48T |
DL Develop |
48T |
EUR 454 |
- Should the Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
DLR-IGF2-Ra-96T |
DL Develop |
96T |
EUR 587 |
- Should the Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RDR-IGF2-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 516 |
Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RDR-IGF2-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 716 |
Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RDR-IGF2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 436 |
Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RDR-IGF2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 601 |
Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RDR-IGF2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 447 |
Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RDR-IGF2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 618 |
Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RDR-IGF2-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 516 |
Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RDR-IGF2-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 716 |
Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RDR-IGF2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 470 |
Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RDR-IGF2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 651 |
Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RD-IGF2-b-48Tests |
Reddot Biotech |
48 Tests |
EUR 494 |
Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RD-IGF2-b-96Tests |
Reddot Biotech |
96 Tests |
EUR 684 |
Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RD-IGF2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 418 |
Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RD-IGF2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 575 |
Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RD-IGF2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 429 |
Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RD-IGF2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 591 |
Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RD-IGF2-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 494 |
Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RD-IGF2-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 684 |
Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RD-IGF2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 450 |
Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit |
|
RD-IGF2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 622 |
 IGF2 antibody |
|
70R-12270 |
Fitzgerald |
100 ug |
EUR 460 |
|
Description: Rabbit polyclonal IGF2 antibody |
IGF2 antibody |
|
70-IR16 |
Fitzgerald |
50 ug |
EUR 327 |
|
Description: Affinity purified Rabbit polyclonal IGF2 antibody |
 IGF2 Antibody |
|
32592-100ul |
SAB |
100ul |
EUR 252 |
IGF2 antibody |
|
10R-I135a |
Fitzgerald |
100 ug |
EUR 555 |
|
Description: Mouse monoclonal IGF2 antibody |
IGF2 Antibody |
|
49302-100ul |
SAB |
100ul |
EUR 333 |
IGF2 Antibody |
|
49302-50ul |
SAB |
50ul |
EUR 239 |
IGF2 Antibody |
|
DF6810 |
Affbiotech |
200ul |
EUR 304 |
|
Description: IGF2 Antibody detects endogenous levels of total IGF2. |
IGF2 Antibody |
|
DF2516 |
Affbiotech |
200ul |
EUR 304 |
|
Description: IGF2 antibody detects endogenous levels of total IGF2. |
IGF2 Antibody |
|
BF0039 |
Affbiotech |
200ul |
EUR 376 |
|
Description: IGF2 antibody detects endogenous levels of total IGF2. |
IGF2 Antibody |
|
CSB-PA011088KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
|
Description: A polyclonal antibody against IGF2. Recognizes IGF2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000 |
IGF2 Antibody |
|
CSB-PA011088KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
|
Description: A polyclonal antibody against IGF2. Recognizes IGF2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000 |
 (OKCD01445)) IGF2 ELISA Kit (Rabbit) (OKCD01445) |
|
OKCD01445 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
|
Description: Description of target: Broad specificity oxidoreductase that catalyzes the NADPH-dependent reduction of a variety of flavins, such as riboflavin, FAD or FMN, biliverdins, methemoglobin and PQQ (pyrroloquinoline quinone). Contributes to heme catabolism and metabolizes linear tetrapyrroles. Can also reduce the complexed Fe3+ iron to Fe2+ in the presence of FMN and NADPH. In the liver, converts biliverdin to bilirubin.;Species reactivity: Rabbit;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.8 ng/mL |
 (OKBB00711)) IGF2 ELISA Kit (Rabbit) (OKBB00711) |
|
OKBB00711 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
|
Description: Description of target: Insulin-like growth factor II is also known as somatomedin A. IGF-2 is a member of the insulin family of polypeptide growth factors that is involved in development and growth. It is paternally expressed in the fetus and placenta. IGF-II is a mitogen for many cell types and an important modulator of muscle growth and differentiation. IGF-II gene is prevalently expressed during prenatal development and its gene activity is regulated by genomic imprinting, in that the allele inherited from the father is active and the allele inherited from the mother is inactive in most normal tissues. IGF-II appears to be induced by placental lactogen during prenatal development. It is a mediator of prolactin-induced alveologenesis; prolactin, IGF-2, and cyclin D1, all of which are overexpressed in breast cancers, are components of a developmental pathway in the mammary gland. The rabbit IGF-II gene is located on chromosome 11. The standard product used in this kit is recombinant rabbit IGF-2, consisting of 67 amino acids in mature form with the molecular mass of 7.5KDa. IGF-1 and IGF-2 share high homology.;Species reactivity: Rabbit;Application: ELISA;Assay info: ;Sensitivity: <2pg/ml |
 IGF2 |
|
LF-PR027 |
Abfrontier |
50 ug |
EUR 177 |
|
Description: IGF2 protein |
 Anti-IGF2/Igf Ii Rabbit Monoclonal Antibody |
|
M00335 |
BosterBio |
100ug/vial |
EUR 397 |
|
Description: Rabbit Monoclonal IGF2/Igf Ii Antibody. Validated in IF, WB and tested in Human. |
 IGF2 Conjugated Antibody |
|
C49302 |
SAB |
100ul |
EUR 397 |
 Anti-IGF2 antibody |
|
STJ24139 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-IGF2 antibody |
|
STJ115940 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-IGF2 antibody |
|
STJ191865 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to IGF2 |
 Antibody (internal region)) Polyclonal IGF2 (aa81-93) Antibody (internal region) |
|
APG00772G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IGF2 (aa81-93) (internal region). This antibody is tested and proven to work in the following applications: |
 IGF2 protein |
|
30R-1836 |
Fitzgerald |
50 ug |
EUR 397 |
|
Description: Purified recombinant Human IGF2 protein |
IGF2 protein |
|
30-AI89 |
Fitzgerald |
50 ug |
EUR 298 |
|
Description: Purified recombinant Human IGF2 protein |
 anti-IGF2 |
|
YF-PA12620 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to IGF2 |
anti-IGF2 |
|
YF-PA12621 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to IGF2 |
 Anti-IGF2-BP2 antibody |
|
STJ93649 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to IGF2-BP2. |
 Rabbit Anti-Human IGF2 monoclonal antibody, clone KK103-4 |
|
CAB-242RH |
Creative Diagnostics |
100 ul |
EUR 777 |
 Polyclonal Antibody (Bovine)) Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine) |
|
4-PAA051Bo01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2694.00
-
EUR 667.00
-
EUR 326.00
-
EUR 218.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2) |
 Polyclonal Antibody (Human)) Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Human) |
|
4-PAA051Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IGF2 (Ala25~Glu91)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 (IGF2) |
 Polyclonal Antibody (Mouse)) Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Mouse) |
|
4-PAA051Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IGF2 (Ala25~Glu91)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 (IGF2) |
 Polyclonal Antibody (Rat)) Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Rat) |
|
4-PAA051Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IGF2 (Ala25~Glu91)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Insulin Like Growth Factor 2 (IGF2) |
 Monoclonal IGF2 Antibody, Clone: 8H1 |
|
APR07954G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A Monoclonal antibody against Human IGF2. The antibodies are raised in Mouse and are from clone 8H1. This antibody is applicable in WB and IHC, FC, ICC, E |
 Monoclonal IGF2 Antibody, Clone: 519CT14.3.6 |
|
AMM02414G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A Monoclonal antibody against Human IGF2. The antibodies are raised in Mouse and are from clone 519CT14.3.6. This antibody is applicable in WB, E |
 IGF2 Blocking Peptide |
|
DF6810-BP |
Affbiotech |
1mg |
EUR 195 |
IGF2 Blocking Peptide |
|
DF2516-BP |
Affbiotech |
1mg |
EUR 195 |
IGF2 Blocking Peptide |
|
BF0039-BP |
Affbiotech |
1mg |
EUR 195 |
 INS-IGF2 siRNA |
|
20-abx920668 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 IGF2 cloning plasmid |
|
CSB-CL011088HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 543
- Sequence: atgggaatcccaatggggaagtcgatgctggtgcttctcaccttcttggccttcgcctcgtgctgcattgctgcttaccgccccagtgagaccctgtgcggcggggagctggtggacaccctccagttcgtctgtggggaccgcggcttctacttcagcaggcccgcaagccgtgt
- Show more
|
|
Description: A cloning plasmid for the IGF2 gene. |
IGF2 cloning plasmid |
|
CSB-CL011088HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 342
- Sequence: atgaccccgggggtcgtccatgccagtccgcctcagtcgcagagggtccctcggcaagcgccctgtgagtgggccattcggaacattggacagaagcccaaagagccaaattgtcacaattgtggaacccacattggcctgagatccaaaacgcttcgaggcaccccaaattacct
- Show more
|
|
Description: A cloning plasmid for the IGF2 gene. |
IGF2 Rabbit Polyclonal Antibody
 antibody)