IL21R Rabbit Polyclonal Antibody

IL21R Rabbit Polyclonal Antibody

IL21R Polyclonal Antibody

ES10875-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IL21R from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Interleukin 21 Receptor (IL21R) ELISA Kit

DLR-IL21R-Hu-48T 48T
EUR 463
  • Should the Human Interleukin 21 Receptor (IL21R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 21 Receptor (IL21R) in samples from tissue homogenates or other biological fluids.

Human Interleukin 21 Receptor (IL21R) ELISA Kit

DLR-IL21R-Hu-96T 96T
EUR 599
  • Should the Human Interleukin 21 Receptor (IL21R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 21 Receptor (IL21R) in samples from tissue homogenates or other biological fluids.

Human Interleukin 21 Receptor (IL21R) ELISA Kit

RDR-IL21R-Hu-48Tests 48 Tests
EUR 481

Human Interleukin 21 Receptor (IL21R) ELISA Kit

RDR-IL21R-Hu-96Tests 96 Tests
EUR 665

Human Interleukin 21 Receptor (IL21R) ELISA Kit

RD-IL21R-Hu-48Tests 48 Tests
EUR 460

Human Interleukin 21 Receptor (IL21R) ELISA Kit

RD-IL21R-Hu-96Tests 96 Tests
EUR 636

IL21R Rabbit pAb

A7468-100ul 100 ul
EUR 308

IL21R Rabbit pAb

A7468-200ul 200 ul
EUR 459

IL21R Rabbit pAb

A7468-20ul 20 ul
EUR 183

IL21R Rabbit pAb

A7468-50ul 50 ul
EUR 223

IL21R antibody

70R-17944 50 ul
EUR 435
Description: Rabbit polyclonal IL21R antibody

IL21R antibody

70R-12366 100 ug
EUR 447
Description: Rabbit polyclonal IL21R antibody

IL21R Antibody

35607-100ul 100ul
EUR 252

IL21R Antibody

1-CSB-PA862061ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against IL21R. Recognizes IL21R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

IL21R Antibody

1-CSB-PA862061ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against IL21R. Recognizes IL21R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

IL21R Antibody

1-CSB-PA443269
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IL21R. Recognizes IL21R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

IL21R Antibody

1-CSB-PA313276
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IL21R. Recognizes IL21R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

IL21R Antibody

1-CSB-PA011634GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IL21R. Recognizes IL21R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal IL21R Antibody (N-Term)

APR04940G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IL21R (N-Term). This antibody is tested and proven to work in the following applications:

IL21R antibody (biotin)

61R-1554 50 ug
EUR 181
Description: Rat monoclonal IL21R antibody (biotin)

IL21R Conjugated Antibody

C35607 100ul
EUR 397

anti- IL21R antibody

FNab04252 100µg
EUR 548.75
  • Immunogen: interleukin 21 receptor
  • Uniprot ID: Q9HBE5
  • Gene ID: 50615
  • Research Area: Cancer, Immunology
Description: Antibody raised against IL21R

Anti-IL21R antibody

PAab04252 100 ug
EUR 386

Anti-IL21R antibody

STJ29604 100 µl
EUR 277
Description: The protein encoded by this gene is a cytokine receptor for interleukin 21 (IL21). It belongs to the type I cytokine receptors, and has been shown to form a heterodimeric receptor complex with the common gamma-chain, a receptor subunit also shared by the receptors for interleukin 2, 4, 7, 9, and 15. This receptor transduces the growth promoting signal of IL21, and is important for the proliferation and differentiation of T cells, B cells, and natural killer (NK) cells. The ligand binding of this receptor leads to the activation of multiple downstream signaling molecules, including JAK1, JAK3, STAT1, and STAT3. Knockout studies of a similar gene in mouse suggest a role for this gene in regulating immunoglobulin production. Three alternatively spliced transcript variants have been described.

Anti-IL21R antibody

STJ192033 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IL21R

IL21R protein

80R-4327 50 ug
EUR 327
Description: Purified Recombinant IL21R protein (His tagged)

IL21R siRNA

20-abx920475
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IL21R siRNA

20-abx920476
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Interleukin 21 Receptor (IL21R) Polyclonal Antibody (Human)

4-PAJ737Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL21R (Leu23~Leu185)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 21 Receptor (IL21R)

Interleukin 21 Receptor (IL21R) Polyclonal Antibody (Human), APC

4-PAJ737Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL21R (Leu23~Leu185)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 21 Receptor (IL21R). This antibody is labeled with APC.

Interleukin 21 Receptor (IL21R) Polyclonal Antibody (Human), Biotinylated

4-PAJ737Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL21R (Leu23~Leu185)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 21 Receptor (IL21R). This antibody is labeled with Biotin.

Interleukin 21 Receptor (IL21R) Polyclonal Antibody (Human), Cy3

4-PAJ737Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL21R (Leu23~Leu185)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 21 Receptor (IL21R). This antibody is labeled with Cy3.

Interleukin 21 Receptor (IL21R) Polyclonal Antibody (Human), FITC

4-PAJ737Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL21R (Leu23~Leu185)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 21 Receptor (IL21R). This antibody is labeled with FITC.

Interleukin 21 Receptor (IL21R) Polyclonal Antibody (Human), HRP

4-PAJ737Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL21R (Leu23~Leu185)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 21 Receptor (IL21R). This antibody is labeled with HRP.

Interleukin 21 Receptor (IL21R) Polyclonal Antibody (Human), PE

4-PAJ737Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL21R (Leu23~Leu185)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 21 Receptor (IL21R). This antibody is labeled with PE.

IL21R cloning plasmid

CSB-CL862061HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1617
  • Sequence: atgccgcgtggctgggccgcccccttgctcctgctgctgctccagggaggctggggctgccccgacctcgtctgctacaccgattacctccagacggtcatctgcatcctggaaatgtggaacctccaccccagcacgctcacccttacctggcaagaccagtatgaagagctga
  • Show more
Description: A cloning plasmid for the IL21R gene.

Interleukin 21 Receptor (IL21R) Antibody

20-abx006974
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin 21 Receptor (IL21R) Antibody

20-abx210525
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin 21 Receptor (IL21R) Antibody

20-abx210526
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin 21 Receptor (IL21R) Antibody

20-abx113248
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin 21 Receptor (IL21R) Antibody

20-abx129153
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 21 Receptor (IL21R) Antibody

20-abx173134
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 21 Receptor (IL21R) Antibody

20-abx320995
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin 21 Receptor (IL21R) Antibody

abx234252-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Interleukin 21 Receptor (IL21R) Antibody

20-abx321907
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin 21 Receptor (IL21R) Polyclonal Antibody (Human), APC-Cy7

4-PAJ737Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL21R (Leu23~Leu185)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 21 Receptor (IL21R). This antibody is labeled with APC-Cy7.

IL21R ELISA KIT|Human

EF005146 96 Tests
EUR 689

Mouse IL21R shRNA Plasmid

20-abx975211
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IL21R shRNA Plasmid

20-abx959387
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Il21r ORF Vector (Rat) (pORF)

ORF068623 1.0 ug DNA
EUR 506

IL21R ORF Vector (Human) (pORF)

ORF005335 1.0 ug DNA
EUR 95

Il21r ORF Vector (Mouse) (pORF)

ORF047864 1.0 ug DNA
EUR 506

Recombinant Interleukin 21 Receptor (IL21R)

4-RPJ737Hu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9HBE5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Interleukin 21 Receptor expressed in: E.coli

Human CellExp? CD360 / IL21R, human recombinant

7373-100
EUR 697

Human CellExp? CD360 / IL21R, human recombinant

7373-20
EUR 245

Human Interleukin 21 Receptor (IL21R) Protein

20-abx166953
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Il21r sgRNA CRISPR Lentivector set (Rat)

K7234101 3 x 1.0 ug
EUR 339

Il21r sgRNA CRISPR Lentivector set (Mouse)

K4394401 3 x 1.0 ug
EUR 339

IL21R sgRNA CRISPR Lentivector set (Human)

K1081801 3 x 1.0 ug
EUR 339

Human Interleukin 21 Receptor (IL21R) ELISA Kit

20-abx151940
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interleukin- 21 receptor, IL21R ELISA KIT

ELI-20140h 96 Tests
EUR 824

Mouse Interleukin- 21 receptor, Il21r ELISA KIT

ELI-08171m 96 Tests
EUR 865

Mouse Interleukin-21 receptor(IL21R) ELISA kit

CSB-EL011634MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin-21 receptor (IL21R) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Interleukin-21 receptor(IL21R) ELISA kit

1-CSB-EL011634MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin-21 receptor(IL21R) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin 21 Receptor (IL21R) CLIA Kit

20-abx495772
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Interleukin 21 Receptor (IL21R) ELISA Kit

abx389637-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Il21r sgRNA CRISPR Lentivector (Rat) (Target 1)

K7234102 1.0 ug DNA
EUR 154

Il21r sgRNA CRISPR Lentivector (Rat) (Target 2)

K7234103 1.0 ug DNA
EUR 154

Il21r sgRNA CRISPR Lentivector (Rat) (Target 3)

K7234104 1.0 ug DNA
EUR 154

Il21r sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4394402 1.0 ug DNA
EUR 154

Il21r sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4394403 1.0 ug DNA
EUR 154

Il21r sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4394404 1.0 ug DNA
EUR 154

IL21R sgRNA CRISPR Lentivector (Human) (Target 1)

K1081802 1.0 ug DNA
EUR 154

IL21R sgRNA CRISPR Lentivector (Human) (Target 2)

K1081803 1.0 ug DNA
EUR 154

IL21R sgRNA CRISPR Lentivector (Human) (Target 3)

K1081804 1.0 ug DNA
EUR 154

IL21R Interleukin-21 Receptor Human Recombinant Protein

PROTQ9HBE5 Regular: 10ug
EUR 317
Description: IL21R produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (20-232 a.a.) and fused to an 8 aa His Tag at C-terminus containing a total of 221 amino acids and having a molecular mass of 25.6kDa.;IL21R shows multiple bands between 28-40kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.

IL21R Protein Vector (Human) (pPB-C-His)

PV021337 500 ng
EUR 329

IL21R Protein Vector (Human) (pPB-N-His)

PV021338 500 ng
EUR 329

IL21R Protein Vector (Human) (pPM-C-HA)

PV021339 500 ng
EUR 329

IL21R Protein Vector (Human) (pPM-C-His)

PV021340 500 ng
EUR 329

IL21R Protein Vector (Rat) (pPB-C-His)

PV274490 500 ng
EUR 603

IL21R Protein Vector (Rat) (pPB-N-His)

PV274491 500 ng
EUR 603

IL21R Protein Vector (Rat) (pPM-C-HA)

PV274492 500 ng
EUR 603

IL21R Protein Vector (Rat) (pPM-C-His)

PV274493 500 ng
EUR 603

IL21R Protein Vector (Mouse) (pPB-C-His)

PV191454 500 ng
EUR 603

IL21R Protein Vector (Mouse) (pPB-N-His)

PV191455 500 ng
EUR 603

IL21R Protein Vector (Mouse) (pPM-C-HA)

PV191456 500 ng
EUR 603

IL21R Protein Vector (Mouse) (pPM-C-His)

PV191457 500 ng
EUR 603

Human Interleukin 21 Receptor(IL21R)ELISA Kit

QY-E04293 96T
EUR 374

Recombinant Human IL21R Protein, His, Insect-10ug

QP12415-10ug 10ug
EUR 201

Recombinant Human IL21R Protein, His, Insect-1mg

QP12415-1mg 1mg
EUR 5251

Recombinant Human IL21R Protein, His, Insect-2ug

QP12415-2ug 2ug
EUR 155

Il21r 3'UTR Luciferase Stable Cell Line

TU110056 1.0 ml Ask for price

Human Interleukin 21 Receptor (IL21R) ELISA Kit

SEJ737Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 21 Receptor (IL21R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 21 Receptor (IL21R) in Tissue homogenates and other biological fluids.

Human Interleukin 21 Receptor (IL21R) ELISA Kit

SEJ737Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 21 Receptor (IL21R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 21 Receptor (IL21R) in Tissue homogenates and other biological fluids.

Human Interleukin 21 Receptor (IL21R) ELISA Kit

SEJ737Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 21 Receptor (IL21R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 21 Receptor (IL21R) in Tissue homogenates and other biological fluids.

Human Interleukin 21 Receptor (IL21R) ELISA Kit

SEJ737Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 21 Receptor (IL21R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 21 Receptor (IL21R) in Tissue homogenates and other biological fluids.

Human Interleukin 21 Receptor (IL21R) ELISA Kit

4-SEJ737Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 21 Receptor elisa. Alternative names of the recognized antigen: CD360
  • NILR
  • Novel interleukin receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 21 Receptor (IL21R) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Il21r 3'UTR GFP Stable Cell Line

TU160056 1.0 ml Ask for price

Il21r 3'UTR Luciferase Stable Cell Line

TU206235 1.0 ml Ask for price

Il21r 3'UTR GFP Stable Cell Line

TU256235 1.0 ml Ask for price

IL21R 3'UTR GFP Stable Cell Line

TU061094 1.0 ml
EUR 2333

IL21R 3'UTR Luciferase Stable Cell Line

TU011094 1.0 ml
EUR 2333

ELISA kit for Human IL21R (Interleukin 21 Receptor)

ELK4659 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 21 Receptor (IL21R). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to In
  • Show more
Description: A sandwich ELISA kit for detection of Interleukin 21 Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

IL21R Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV646033 1.0 ug DNA
EUR 682

IL21R Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV646037 1.0 ug DNA
EUR 682

IL21R Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV646038 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

IL21R Rabbit Polyclonal Antibody