ING2 Rabbit Polyclonal Antibody

ING2 Rabbit Polyclonal Antibody

ING2 Polyclonal Antibody

ABP58938-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ING2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ING2 from Human, Mouse. This ING2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING2 protein

ING2 Polyclonal Antibody

ABP58938-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ING2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ING2 from Human, Mouse. This ING2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING2 protein

ING2 Polyclonal Antibody

ABP58938-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ING2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ING2 from Human, Mouse. This ING2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING2 protein

ING2 Rabbit pAb

A12266-100ul 100 ul
EUR 308

ING2 Rabbit pAb

A12266-200ul 200 ul
EUR 459

ING2 Rabbit pAb

A12266-20ul 20 ul
EUR 183

ING2 Rabbit pAb

A12266-50ul 50 ul
EUR 223

ING2 Rabbit pAb

A8726-100ul 100 ul
EUR 308

ING2 Rabbit pAb

A8726-200ul 200 ul
EUR 459

ING2 Rabbit pAb

A8726-20ul 20 ul Ask for price

ING2 Rabbit pAb

A8726-50ul 50 ul Ask for price

ING2 Antibody

ABD2633 100 ug
EUR 438

ING2 Antibody

ABD8240 100 ug
EUR 438

ING2 Antibody

35779-100ul 100ul
EUR 252

ING2 antibody

10R-10245 50 ul
EUR 219
Description: Mouse monoclonal ING2 antibody

ING2 antibody

70R-17969 50 ul
EUR 435
Description: Rabbit polyclonal ING2 antibody

ING2 Antibody

DF8240 200ul
EUR 304
Description: ING2 Antibody detects endogenous levels of total ING2.

ING2 Antibody

DF2633 200ul
EUR 304
Description: ING2 antibody detects endogenous levels of total ING2.

ING2 Antibody

1-CSB-PA011713GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ING2. Recognizes ING2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ING2 Antibody

1-CSB-PA777986
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ING2. Recognizes ING2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

ING2 Antibody

1-CSB-PA266125
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ING2. Recognizes ING2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ING2 Conjugated Antibody

C35779 100ul
EUR 397

anti- ING2 antibody

FNab04310 100µg
EUR 505.25
  • Immunogen: inhibitor of growth family, member 2
  • Uniprot ID: Q9H160
  • Gene ID: 3622
  • Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against ING2

Anti-ING2 antibody

PAab04310 100 ug
EUR 355

Anti-ING2 antibody

STJ111390 100 µl
EUR 277
Description: This gene is a member of the inhibitor of growth (ING) family. Members of the ING family associate with and modulate the activity of histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes and function in DNA repair and apoptosis. Alternative splicing results in multiple transcript variants.

Anti-ING2 antibody

STJ114156 100 µl
EUR 277
Description: This gene is a member of the inhibitor of growth (ING) family. Members of the ING family associate with and modulate the activity of histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes and function in DNA repair and apoptosis. Alternative splicing results in multiple transcript variants.

Anti-ING2 antibody

STJ191949 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ING2

ING2 siRNA

20-abx920605
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ING2 siRNA

20-abx920606
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ING2

YF-PA12744 50 ul
EUR 363
Description: Mouse polyclonal to ING2

anti-ING2

YF-PA12745 50 ul
EUR 363
Description: Mouse polyclonal to ING2

Anti-ING2 / ING1L antibody

STJ70185 100 µg
EUR 359

ING2 cloning plasmid

CSB-CL867125HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atgttagggcagcagcagcagcaactgtactcgtcggctgcgctcctgaccggggagcggagccggctgctcacctgctacgtgcaggactaccttgagtgcgtggagtcgctgccccacgacatgcagaggaacgtgtctgtgctgcgagagctggacaacaaatatcaagaaac
  • Show more
Description: A cloning plasmid for the ING2 gene.

ING2 Blocking Peptide

DF8240-BP 1mg
EUR 195

ING2 Blocking Peptide

DF2633-BP 1mg
EUR 195

Anti-ING2 (1D1)

YF-MA13827 100 ug
EUR 363
Description: Mouse monoclonal to ING2

Mouse ING2 shRNA Plasmid

20-abx976900
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ING2 ELISA KIT|Human

EF010337 96 Tests
EUR 689

ING2 protein (His tag)

80R-3524 100 ug
EUR 327
Description: Purified recombinant ING2 protein (His tag)

Human ING2 shRNA Plasmid

20-abx952426
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ING2 Recombinant Protein (Human)

RP016141 100 ug Ask for price

pcDNA3.1-Flag-ING2 Plasmid

PVTB01081-2a 2 ug
EUR 356

ING2 Recombinant Protein (Rat)

RP206021 100 ug Ask for price

ING2 Recombinant Protein (Mouse)

RP143828 100 ug Ask for price

Inhibitor of Growth Protein 2 (ING2) Antibody

20-abx123607
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 2 (ING2) Antibody

20-abx126007
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 2 (ING2) Antibody

20-abx113133
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 2 (ING2) Antibody

abx036708-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ING2 Rabbit Polyclonal Antibody