LPIN1 Rabbit Polyclonal Antibody
LPIN1 Polyclonal Antibody |
ES10897-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against LPIN1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LPIN1 Polyclonal Antibody |
ABP59136-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human LPIN1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LPIN1 from Human, Mouse. This LPIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPIN1 protein |
LPIN1 Polyclonal Antibody |
ABP59136-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human LPIN1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LPIN1 from Human, Mouse. This LPIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPIN1 protein |
LPIN1 Polyclonal Antibody |
ABP59136-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LPIN1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LPIN1 from Human, Mouse. This LPIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPIN1 protein |
Mouse Lipin 1 (LPIN1) ELISA Kit |
DLR-LPIN1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Lipin 1 (LPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lipin 1 (LPIN1) in samples from tissue homogenates or other biological fluids. |
Mouse Lipin 1 (LPIN1) ELISA Kit |
DLR-LPIN1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Lipin 1 (LPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lipin 1 (LPIN1) in samples from tissue homogenates or other biological fluids. |
Rat Lipin 1 (LPIN1) ELISA Kit |
DLR-LPIN1-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Lipin 1 (LPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lipin 1 (LPIN1) in samples from tissue homogenates or other biological fluids. |
Rat Lipin 1 (LPIN1) ELISA Kit |
DLR-LPIN1-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Lipin 1 (LPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lipin 1 (LPIN1) in samples from tissue homogenates or other biological fluids. |
Mouse Lipin 1 (LPIN1) ELISA Kit |
RD-LPIN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Lipin 1 (LPIN1) ELISA Kit |
RD-LPIN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Lipin 1 (LPIN1) ELISA Kit |
RD-LPIN1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Lipin 1 (LPIN1) ELISA Kit |
RD-LPIN1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Mouse Lipin 1 (LPIN1) ELISA Kit |
RDR-LPIN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Lipin 1 (LPIN1) ELISA Kit |
RDR-LPIN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Lipin 1 (LPIN1) ELISA Kit |
RDR-LPIN1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Lipin 1 (LPIN1) ELISA Kit |
RDR-LPIN1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
LPIN1 Rabbit pAb |
A14111-100ul |
Abclonal |
100 ul |
EUR 308 |
LPIN1 Rabbit pAb |
A14111-200ul |
Abclonal |
200 ul |
EUR 459 |
LPIN1 Rabbit pAb |
A14111-20ul |
Abclonal |
20 ul |
EUR 183 |
LPIN1 Rabbit pAb |
A14111-50ul |
Abclonal |
50 ul |
EUR 223 |
LPIN1 Rabbit pAb |
A8486-100ul |
Abclonal |
100 ul |
EUR 308 |
LPIN1 Rabbit pAb |
A8486-200ul |
Abclonal |
200 ul |
EUR 459 |
LPIN1 Rabbit pAb |
A8486-20ul |
Abclonal |
20 ul |
EUR 183 |
LPIN1 Rabbit pAb |
A8486-50ul |
Abclonal |
50 ul |
EUR 223 |
Phosphatidate Phosphatase LPIN1 (LPIN1) Antibody |
abx038051-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Phosphatidate Phosphatase LPIN1 (LPIN1) Antibody |
20-abx006238 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Phosphatidate Phosphatase LPIN1 (LPIN1) Antibody |
20-abx321300 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LPIN1 Antibody |
AF7585 |
Affbiotech |
200ul |
EUR 376 |
Description: LPIN1 Antibody detects endogenous levels of LPIN1. |
LPIN1 Antibody |
39971-100ul |
SAB |
100ul |
EUR 390 |
LPIN1 Antibody |
47149-100ul |
SAB |
100ul |
EUR 252 |
LPIN1 Antibody |
DF7924 |
Affbiotech |
200ul |
EUR 304 |
Description: LPIN1 Antibody detects endogenous levels of total LPIN1. |
LPIN1 Antibody |
1-CSB-PA614805ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against LPIN1. Recognizes LPIN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
LPIN1 (Phospho-Thr14) Polyclonal Conjugated Antibody |
C12950 |
SAB |
100ul |
EUR 397 |
LPIN1 Conjugated Antibody |
C47149 |
SAB |
100ul |
EUR 397 |
Anti-LPIN1 antibody |
STJ110784 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their full-length structures have not been determined. |
Anti-LPIN1 antibody |
STJ192055 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LPIN1 |
Anti-LPIN1 antibody |
STJ116046 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their full-length structures have not been determined. |
Polyclonal LPIN1 / Lipin 1 Antibody (C-Terminus) |
APR08260G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPIN1 / Lipin 1 (C-Terminus). This antibody is tested and proven to work in the following applications: |
LPIN1 siRNA |
20-abx922769 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LPIN1 siRNA |
20-abx922770 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-LPIN1(Thr14) Antibody |
AF7085 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-LPIN1(Thr14) Antibody detects endogenous levels of LPIN1 only when phosphorylated at Thr14. |
Lipin 1 (LPIN1) Antibody |
20-abx173371 |
Abbexa |
|
|
|
Lipin 1 (LPIN1) Antibody |
20-abx177375 |
Abbexa |
|
|
|
Lipin 1 (LPIN1) Antibody |
20-abx177376 |
Abbexa |
|
|
|
Lipin 1 (LPIN1) Antibody |
20-abx177377 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Lipin 1 (LPIN1) Antibody |
abx431255-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
LPIN1 (Phospho-Thr14) Antibody |
12950-100ul |
SAB |
100ul |
EUR 252 |
LPIN1 (Phospho-Thr14) Antibody |
12950-50ul |
SAB |
50ul |
EUR 187 |
Mouse Phosphatidate phosphatase LPIN1, Lpin1 ELISA KIT |
ELI-12626m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Phosphatidate phosphatase LPIN1, LPIN1 ELISA KIT |
ELI-42202h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human Phosphatidate phosphatase LPIN1 (LPIN1) |
KTE61788-48T |
Abbkine |
48T |
EUR 332 |
- Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Phosphatidate phosphatase LPIN1 (LPIN1) |
KTE61788-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Phosphatidate phosphatase LPIN1 (LPIN1) |
KTE61788-96T |
Abbkine |
96T |
EUR 539 |
- Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Phosphatidate phosphatase LPIN1 (LPIN1) |
KTE71164-48T |
Abbkine |
48T |
EUR 332 |
- Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Phosphatidate phosphatase LPIN1 (LPIN1) |
KTE71164-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Phosphatidate phosphatase LPIN1 (LPIN1) |
KTE71164-96T |
Abbkine |
96T |
EUR 539 |
- Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
LPIN1 Blocking Peptide |
AF7585-BP |
Affbiotech |
1mg |
EUR 195 |
LPIN1 cloning plasmid |
CSB-CL614805HU-10ug |
Cusabio |
10ug |
EUR 859 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2673
- Sequence: atgaattacgtggggcagttagccggccaggtgtttgtcaccgtgaaggagctctacaaggggctgaatcccgccacactctcagggtgcattgacatcattgtcatccgccagcccaatggaaacctccaatgctcccctttccacgtccgctttgggaagatgggggtcctgc
- Show more
|
Description: A cloning plasmid for the LPIN1 gene. |
LPIN1 Blocking Peptide |
DF7924-BP |
Affbiotech |
1mg |
EUR 195 |
Lipin 1 (LPIN1) |
RA25079 |
Neuromics |
100 ul |
EUR 461 |
Lpin1 ELISA Kit| Mouse Phosphatidate phosphatase LPIN1 ELISA Ki |
EF015392 |
Lifescience Market |
96 Tests |
EUR 689 |
Human LPIN1 shRNA Plasmid |
20-abx958058 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse LPIN1 shRNA Plasmid |
20-abx970363 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse Lipin 1 (LPIN1) Protein |
20-abx654202 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Lipin 1 (LPIN1) Protein |
20-abx654203 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat Lipin 1 (LPIN1) Protein |
20-abx654204 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Phospho-LPIN1(Thr14) Blocking Peptide |
AF7085-BP |
Affbiotech |
1mg |
EUR 195 |
LPIN1 ORF Vector (Human) (pORF) |
ORF006053 |
ABM |
1.0 ug DNA |
EUR 95 |
Lpin1 ORF Vector (Rat) (pORF) |
ORF069944 |
ABM |
1.0 ug DNA |
EUR 506 |
Lpin1 ORF Vector (Mouse) (pORF) |
ORF049327 |
ABM |
1.0 ug DNA |
EUR 506 |
Lpin1 ORF Vector (Mouse) (pORF) |
ORF049328 |
ABM |
1.0 ug DNA |
EUR 506 |
Lpin1 ORF Vector (Mouse) (pORF) |
ORF049329 |
ABM |
1.0 ug DNA |
EUR 506 |
LPIN1 ELISA Kit (Human) (OKCD04380) |
OKCD04380 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.43 ng/mL |
LPIN1 ELISA Kit (Rat) (OKCD04508) |
OKCD04508 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.127 ng/mL |
LPIN1 ELISA Kit (Mouse) (OKCD08947) |
OKCD08947 |
Aviva Systems Biology |
96 Wells |
EUR 1001 |
Description: Description of target: Plays important roles in controlling the metabolism of fatty acids at differents levels. Acts as a magnesium-dependent phosphatidate phosphatase enzyme which catalyzes the conversion of phosphatidic acid to diacylglycerol during triglyceride, phosphatidylcholine and phosphatidylethanolamine biosynthesis. Acts also as nuclear transcriptional coactivator for PPARGC1A/PPARA regulatory pathway to modulate lipid metabolism gene expression. Is involved in adipocyte differentiation. Isoform 1 is recruited at the mitochondrion outer membrane and is involved in mitochondrial fission by converting phosphatidic acid to diacylglycerol.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.051ng/mL |
LPIN1 ELISA Kit (Mouse) (OKDD00738) |
OKDD00738 |
Aviva Systems Biology |
96 Wells |
EUR 988 |
Description: Description of target: Plays important roles in controlling the metabolism of fatty acids at differents levels. acts as a magnesium-dependent phosphatidate phosphatase enzyme which catalyzes the conversion of phosphatidic acid to diacylglycerol during triglyceride, phosphatidylcholine and phosphatidylethanolamine biosynthesis. acts also as nuclear transcriptional coactivator for ppargc1a/ppara regulatory pathway to modulate lipid metabolism gene expression. is involved in adipocyte differentiation. isoform 1 is recruited at the mitochondrion outer membrane and is involved in mitochondrial fission by converting phosphatidic acid to diacylglycerol.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.051 ng/mL |
Rat Lipin 1 (LPIN1) ELISA Kit |
20-abx155786 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Lipin 1 (LPIN1) ELISA Kit |
20-abx154329 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Lipin 1 (LPIN1) ELISA Kit |
20-abx258604 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Lipin 1 (LPIN1) CLIA Kit |
20-abx495221 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Lipin 1 (LPIN1) CLIA Kit |
20-abx495222 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Lipin 1 (LPIN1) CLIA Kit |
20-abx495223 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
LPIN1 sgRNA CRISPR Lentivector set (Human) |
K1227101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lpin1 sgRNA CRISPR Lentivector set (Mouse) |
K5026901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lpin1 sgRNA CRISPR Lentivector set (Rat) |
K7617901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Lipin 1 (LPIN1) ELISA Kit |
SEG501Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids. |
Human Lipin 1 (LPIN1) ELISA Kit |
SEG501Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids. |
Human Lipin 1 (LPIN1) ELISA Kit |
SEG501Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids. |
Human Lipin 1 (LPIN1) ELISA Kit |
SEG501Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids. |
Human Lipin 1 (LPIN1) ELISA Kit |
4-SEG501Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Lipin 1 elisa. Alternative names of the recognized antigen: Phosphatidate phosphatase LPIN1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lipin 1 (LPIN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Lipin 1 (LPIN1) ELISA Kit |
SEG501Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids. |
Mouse Lipin 1 (LPIN1) ELISA Kit |
SEG501Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids. |
Mouse Lipin 1 (LPIN1) ELISA Kit |
SEG501Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids. |
Mouse Lipin 1 (LPIN1) ELISA Kit |
SEG501Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids. |
Mouse Lipin 1 (LPIN1) ELISA Kit |
4-SEG501Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Lipin 1 elisa. Alternative names of the recognized antigen: Phosphatidate phosphatase LPIN1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Lipin 1 (LPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Lipin 1 (LPIN1) ELISA Kit |
SEG501Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids. |
Rat Lipin 1 (LPIN1) ELISA Kit |
SEG501Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids. |
Rat Lipin 1 (LPIN1) ELISA Kit |
SEG501Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids. |
Rat Lipin 1 (LPIN1) ELISA Kit |
SEG501Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids. |
Rat Lipin 1 (LPIN1) ELISA Kit |
4-SEG501Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Lipin 1 elisa. Alternative names of the recognized antigen: Phosphatidate phosphatase LPIN1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Lipin 1 (LPIN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human LPIN1 (Lipin 1) |
ELK5420 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipin 1 (LPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipin 1 (LPIN1). N
- Show more
|
Description: A sandwich ELISA kit for detection of Lipin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat LPIN1 (Lipin 1) |
ELK6423 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipin 1 (LPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipin 1 (LPIN1). N
- Show more
|
Description: A sandwich ELISA kit for detection of Lipin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse LPIN1 (Lipin 1) |
ELK6460 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipin 1 (LPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipin 1 (LPIN1). N
- Show more
|
Description: A sandwich ELISA kit for detection of Lipin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
LPIN1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1227102 |
ABM |
1.0 ug DNA |
EUR 154 |
LPIN1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1227103 |
ABM |
1.0 ug DNA |
EUR 154 |
LPIN1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1227104 |
ABM |
1.0 ug DNA |
EUR 154 |
Lpin1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K5026902 |
ABM |
1.0 ug DNA |
EUR 154 |
Lpin1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K5026903 |
ABM |
1.0 ug DNA |
EUR 154 |
Lpin1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K5026904 |
ABM |
1.0 ug DNA |
EUR 154 |
Lpin1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7617902 |
ABM |
1.0 ug DNA |
EUR 154 |
Lpin1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7617903 |
ABM |
1.0 ug DNA |
EUR 154 |
Lpin1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7617904 |
ABM |
1.0 ug DNA |
EUR 154 |
LPIN1 Protein Vector (Human) (pPB-C-His) |
PV024209 |
ABM |
500 ng |
EUR 329 |
LPIN1 Protein Vector (Human) (pPB-N-His) |
PV024210 |
ABM |
500 ng |
EUR 329 |
LPIN1 Protein Vector (Human) (pPM-C-HA) |
PV024211 |
ABM |
500 ng |
EUR 329 |
LPIN1 Protein Vector (Human) (pPM-C-His) |
PV024212 |
ABM |
500 ng |
EUR 329 |
LPIN1 Protein Vector (Rat) (pPB-C-His) |
PV279774 |
ABM |
500 ng |
EUR 1166 |
LPIN1 Protein Vector (Rat) (pPB-N-His) |
PV279775 |
ABM |
500 ng |
EUR 1166 |
LPIN1 Protein Vector (Rat) (pPM-C-HA) |
PV279776 |
ABM |
500 ng |
EUR 1166 |
LPIN1 Protein Vector (Rat) (pPM-C-His) |
PV279777 |
ABM |
500 ng |
EUR 1166 |
LPIN1 Protein Vector (Mouse) (pPB-C-His) |
PV197306 |
ABM |
500 ng |
EUR 1065 |
LPIN1 Protein Vector (Mouse) (pPB-N-His) |
PV197307 |
ABM |
500 ng |
EUR 1065 |
LPIN1 Protein Vector (Mouse) (pPM-C-HA) |
PV197308 |
ABM |
500 ng |
EUR 1065 |
LPIN1 Protein Vector (Mouse) (pPM-C-His) |
PV197309 |
ABM |
500 ng |
EUR 1065 |
LPIN1 Protein Vector (Mouse) (pPB-C-His) |
PV197310 |
ABM |
500 ng |
EUR 1065 |
LPIN1 Protein Vector (Mouse) (pPB-N-His) |
PV197311 |
ABM |
500 ng |
EUR 1065 |
LPIN1 Protein Vector (Mouse) (pPM-C-HA) |
PV197312 |
ABM |
500 ng |
EUR 1065 |
LPIN1 Protein Vector (Mouse) (pPM-C-His) |
PV197313 |
ABM |
500 ng |
EUR 1065 |
LPIN1 Protein Vector (Mouse) (pPB-C-His) |
PV197314 |
ABM |
500 ng |
EUR 1065 |
LPIN1 Protein Vector (Mouse) (pPB-N-His) |
PV197315 |
ABM |
500 ng |
EUR 1065 |
LPIN1 Protein Vector (Mouse) (pPM-C-HA) |
PV197316 |
ABM |
500 ng |
EUR 1065 |
LPIN1 Protein Vector (Mouse) (pPM-C-His) |
PV197317 |
ABM |
500 ng |
EUR 1065 |
Lpin1 3'UTR GFP Stable Cell Line |
TU162543 |
ABM |
1.0 ml |
Ask for price |
Lpin1 3'UTR Luciferase Stable Cell Line |
TU212500 |
ABM |
1.0 ml |
Ask for price |
LPIN1 3'UTR Luciferase Stable Cell Line |
TU012585 |
ABM |
1.0 ml |
EUR 2333 |
Lpin1 3'UTR Luciferase Stable Cell Line |
TU112543 |
ABM |
1.0 ml |
Ask for price |
LPIN1 3'UTR GFP Stable Cell Line |
TU062585 |
ABM |
1.0 ml |
EUR 2333 |
Lpin1 3'UTR GFP Stable Cell Line |
TU262500 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
LPIN1 Rabbit Polyclonal Antibody