LPIN1 Rabbit Polyclonal Antibody

LPIN1 Rabbit Polyclonal Antibody

LPIN1 Polyclonal Antibody

ABP59136-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LPIN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LPIN1 from Human, Mouse. This LPIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPIN1 protein

LPIN1 Polyclonal Antibody

ABP59136-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LPIN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LPIN1 from Human, Mouse. This LPIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPIN1 protein

LPIN1 Polyclonal Antibody

ES10897-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LPIN1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LPIN1 Polyclonal Antibody

ES10897-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LPIN1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Mouse Lipin 1 (LPIN1) ELISA Kit

DLR-LPIN1-Mu-48T 48T
EUR 527
  • Should the Mouse Lipin 1 (LPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lipin 1 (LPIN1) in samples from tissue homogenates or other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit

DLR-LPIN1-Mu-96T 96T
EUR 688
  • Should the Mouse Lipin 1 (LPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lipin 1 (LPIN1) in samples from tissue homogenates or other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit

DLR-LPIN1-Ra-48T 48T
EUR 549
  • Should the Rat Lipin 1 (LPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lipin 1 (LPIN1) in samples from tissue homogenates or other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit

DLR-LPIN1-Ra-96T 96T
EUR 718
  • Should the Rat Lipin 1 (LPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lipin 1 (LPIN1) in samples from tissue homogenates or other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit

RDR-LPIN1-Mu-48Tests 48 Tests
EUR 557

Mouse Lipin 1 (LPIN1) ELISA Kit

RDR-LPIN1-Mu-96Tests 96 Tests
EUR 774

Rat Lipin 1 (LPIN1) ELISA Kit

RDR-LPIN1-Ra-48Tests 48 Tests
EUR 583

Rat Lipin 1 (LPIN1) ELISA Kit

RDR-LPIN1-Ra-96Tests 96 Tests
EUR 811

Mouse Lipin 1 (LPIN1) ELISA Kit

RD-LPIN1-Mu-48Tests 48 Tests
EUR 533

Mouse Lipin 1 (LPIN1) ELISA Kit

RD-LPIN1-Mu-96Tests 96 Tests
EUR 740

Rat Lipin 1 (LPIN1) ELISA Kit

RD-LPIN1-Ra-48Tests 48 Tests
EUR 557

Rat Lipin 1 (LPIN1) ELISA Kit

RD-LPIN1-Ra-96Tests 96 Tests
EUR 775

LPIN1 Rabbit pAb

A14111-100ul 100 ul
EUR 308

LPIN1 Rabbit pAb

A14111-200ul 200 ul
EUR 459

LPIN1 Rabbit pAb

A14111-20ul 20 ul
EUR 183

LPIN1 Rabbit pAb

A14111-50ul 50 ul
EUR 223

LPIN1 Rabbit pAb

A8486-100ul 100 ul
EUR 308

LPIN1 Rabbit pAb

A8486-200ul 200 ul
EUR 459

LPIN1 Rabbit pAb

A8486-20ul 20 ul
EUR 183

LPIN1 Rabbit pAb

A8486-50ul 50 ul
EUR 223

Phosphatidate Phosphatase LPIN1 (LPIN1) Antibody

20-abx006238
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidate Phosphatase LPIN1 (LPIN1) Antibody

abx038051-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phosphatidate Phosphatase LPIN1 (LPIN1) Antibody

20-abx321300
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

LPIN1 Antibody

47149-100ul 100ul
EUR 252

LPIN1 Antibody

39971-100ul 100ul
EUR 390

LPIN1 Antibody

1-CSB-PA614805ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LPIN1. Recognizes LPIN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LPIN1 Antibody

DF7924 200ul
EUR 304
Description: LPIN1 Antibody detects endogenous levels of total LPIN1.

LPIN1 Antibody

AF7585 200ul
EUR 376
Description: LPIN1 Antibody detects endogenous levels of LPIN1.

LPIN1 Antibody

ABD7924 100 ug
EUR 438

LPIN1 (Phospho-Thr14) Polyclonal Conjugated Antibody

C12950 100ul
EUR 397

LPIN1 Conjugated Antibody

C47149 100ul
EUR 397

Anti-LPIN1 antibody

STJ110784 100 µl
EUR 277
Description: This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their full-length structures have not been determined.

Anti-LPIN1 antibody

STJ116046 100 µl
EUR 277
Description: This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their full-length structures have not been determined.

Anti-LPIN1 antibody

STJ192055 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LPIN1

Polyclonal LPIN1 / Lipin 1 Antibody (C-Terminus)

APR08260G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPIN1 / Lipin 1 (C-Terminus). This antibody is tested and proven to work in the following applications:

LPIN1 siRNA

20-abx922769
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LPIN1 siRNA

20-abx922770
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LPIN1 (Phospho-Thr14) Antibody

12950-100ul 100ul
EUR 252

LPIN1 (Phospho-Thr14) Antibody

12950-50ul 50ul
EUR 187

Lipin 1 (LPIN1) Antibody

20-abx177375
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lipin 1 (LPIN1) Antibody

20-abx177376
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lipin 1 (LPIN1) Antibody

20-abx177377
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Lipin 1 (LPIN1) Antibody

20-abx173371
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Phospho-LPIN1(Thr14) Antibody

AF7085 200ul
EUR 376
Description: Phospho-LPIN1(Thr14) Antibody detects endogenous levels of LPIN1 only when phosphorylated at Thr14.

Lipin 1 (LPIN1) Antibody

abx431255-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Mouse Phosphatidate phosphatase LPIN1, Lpin1 ELISA KIT

ELI-12626m 96 Tests
EUR 865

Human Phosphatidate phosphatase LPIN1, LPIN1 ELISA KIT

ELI-42202h 96 Tests
EUR 824

ELISA kit for Mouse Phosphatidate phosphatase LPIN1 (LPIN1)

KTE71164-48T 48T
EUR 332
  • Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Phosphatidate phosphatase LPIN1 (LPIN1)

KTE71164-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Phosphatidate phosphatase LPIN1 (LPIN1)

KTE71164-96T 96T
EUR 539
  • Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidate phosphatase LPIN1 (LPIN1)

KTE61788-48T 48T
EUR 332
  • Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidate phosphatase LPIN1 (LPIN1)

KTE61788-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidate phosphatase LPIN1 (LPIN1)

KTE61788-96T 96T
EUR 539
  • Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

LPIN1 Blocking Peptide

DF7924-BP 1mg
EUR 195

LPIN1 Blocking Peptide

AF7585-BP 1mg
EUR 195

LPIN1 cloning plasmid

CSB-CL614805HU-10ug 10ug
EUR 859
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2673
  • Sequence: atgaattacgtggggcagttagccggccaggtgtttgtcaccgtgaaggagctctacaaggggctgaatcccgccacactctcagggtgcattgacatcattgtcatccgccagcccaatggaaacctccaatgctcccctttccacgtccgctttgggaagatgggggtcctgc
  • Show more
Description: A cloning plasmid for the LPIN1 gene.

Lipin 1 (LPIN1)

RA25079 100 ul
EUR 461

Lpin1 ELISA Kit| Mouse Phosphatidate phosphatase LPIN1 ELISA Ki

EF015392 96 Tests
EUR 689

LPIN1 ELISA KIT|Human

EF005209 96 Tests
EUR 689

Human LPIN1 shRNA Plasmid

20-abx958058
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LPIN1 shRNA Plasmid

20-abx970363
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-LPIN1(Thr14) Blocking Peptide

AF7085-BP 1mg
EUR 195

Mouse Lipin 1 (LPIN1) Protein

20-abx654202
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Lipin 1 (LPIN1) Protein

20-abx654203
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Lipin 1 (LPIN1) Protein

20-abx654204
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Lpin1 ORF Vector (Rat) (pORF)

ORF069944 1.0 ug DNA
EUR 506

LPIN1 ORF Vector (Human) (pORF)

ORF006053 1.0 ug DNA
EUR 95

Lpin1 ORF Vector (Mouse) (pORF)

ORF049327 1.0 ug DNA
EUR 506

Lpin1 ORF Vector (Mouse) (pORF)

ORF049328 1.0 ug DNA
EUR 506

Lpin1 ORF Vector (Mouse) (pORF)

ORF049329 1.0 ug DNA
EUR 506

Rat Lipin 1 (LPIN1) ELISA Kit

20-abx155786
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Lipin 1 (LPIN1) ELISA Kit

20-abx154329
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Lipin 1 (LPIN1) ELISA Kit

20-abx258604
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Lipin 1 (LPIN1) CLIA Kit

20-abx495221
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Lipin 1 (LPIN1) CLIA Kit

20-abx495222
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Lipin 1 (LPIN1) CLIA Kit

20-abx495223
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Lpin1 sgRNA CRISPR Lentivector set (Mouse)

K5026901 3 x 1.0 ug
EUR 339

Lpin1 sgRNA CRISPR Lentivector set (Rat)

K7617901 3 x 1.0 ug
EUR 339

LPIN1 sgRNA CRISPR Lentivector set (Human)

K1227101 3 x 1.0 ug
EUR 339

Human Lipin 1(LPIN1)ELISA Kit

QY-E00226 96T
EUR 361

Human Lipin 1 (LPIN1) ELISA Kit

SEG501Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipin 1 (LPIN1) ELISA Kit

SEG501Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipin 1 (LPIN1) ELISA Kit

SEG501Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipin 1 (LPIN1) ELISA Kit

SEG501Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipin 1 (LPIN1) ELISA Kit

4-SEG501Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lipin 1 elisa. Alternative names of the recognized antigen: Phosphatidate phosphatase LPIN1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lipin 1 (LPIN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Lipin 1 (LPIN1) ELISA Kit

SEG501Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit

SEG501Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit

SEG501Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit

SEG501Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit

4-SEG501Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lipin 1 elisa. Alternative names of the recognized antigen: Phosphatidate phosphatase LPIN1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Lipin 1 (LPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Lipin 1 (LPIN1) ELISA Kit

SEG501Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit

SEG501Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit

SEG501Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit

SEG501Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit

4-SEG501Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lipin 1 elisa. Alternative names of the recognized antigen: Phosphatidate phosphatase LPIN1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Lipin 1 (LPIN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat LPIN1 (Lipin 1)

ELK6423 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipin 1 (LPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipin 1 (LPIN1). N
  • Show more
Description: A sandwich ELISA kit for detection of Lipin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse LPIN1 (Lipin 1)

ELK6460 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipin 1 (LPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipin 1 (LPIN1). N
  • Show more
Description: A sandwich ELISA kit for detection of Lipin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human LPIN1 (Lipin 1)

ELK5420 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipin 1 (LPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipin 1 (LPIN1). N
  • Show more
Description: A sandwich ELISA kit for detection of Lipin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Lpin1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5026902 1.0 ug DNA
EUR 154

Lpin1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5026903 1.0 ug DNA
EUR 154

Lpin1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5026904 1.0 ug DNA
EUR 154

Lpin1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7617902 1.0 ug DNA
EUR 154

Lpin1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7617903 1.0 ug DNA
EUR 154

Lpin1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7617904 1.0 ug DNA
EUR 154

LPIN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1227102 1.0 ug DNA
EUR 154

LPIN1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1227103 1.0 ug DNA
EUR 154

LPIN1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1227104 1.0 ug DNA
EUR 154

LPIN1 Protein Vector (Human) (pPB-C-His)

PV024209 500 ng
EUR 329

LPIN1 Protein Vector (Human) (pPB-N-His)

PV024210 500 ng
EUR 329

LPIN1 Protein Vector (Human) (pPM-C-HA)

PV024211 500 ng
EUR 329

LPIN1 Protein Vector (Human) (pPM-C-His)

PV024212 500 ng
EUR 329

LPIN1 Protein Vector (Rat) (pPB-C-His)

PV279774 500 ng
EUR 1166

LPIN1 Protein Vector (Rat) (pPB-N-His)

PV279775 500 ng
EUR 1166

LPIN1 Protein Vector (Rat) (pPM-C-HA)

PV279776 500 ng
EUR 1166

LPIN1 Protein Vector (Rat) (pPM-C-His)

PV279777 500 ng
EUR 1166

LPIN1 Protein Vector (Mouse) (pPB-C-His)

PV197306 500 ng
EUR 1065

LPIN1 Protein Vector (Mouse) (pPB-N-His)

PV197307 500 ng
EUR 1065

LPIN1 Protein Vector (Mouse) (pPM-C-HA)

PV197308 500 ng
EUR 1065

LPIN1 Protein Vector (Mouse) (pPM-C-His)

PV197309 500 ng
EUR 1065

LPIN1 Protein Vector (Mouse) (pPB-C-His)

PV197310 500 ng
EUR 1065

LPIN1 Protein Vector (Mouse) (pPB-N-His)

PV197311 500 ng
EUR 1065

LPIN1 Protein Vector (Mouse) (pPM-C-HA)

PV197312 500 ng
EUR 1065

LPIN1 Protein Vector (Mouse) (pPM-C-His)

PV197313 500 ng
EUR 1065

LPIN1 Protein Vector (Mouse) (pPB-C-His)

PV197314 500 ng
EUR 1065

LPIN1 Protein Vector (Mouse) (pPB-N-His)

PV197315 500 ng
EUR 1065

LPIN1 Protein Vector (Mouse) (pPM-C-HA)

PV197316 500 ng
EUR 1065

LPIN1 Protein Vector (Mouse) (pPM-C-His)

PV197317 500 ng
EUR 1065

Lpin1 3'UTR Luciferase Stable Cell Line

TU112543 1.0 ml Ask for price

Lpin1 3'UTR GFP Stable Cell Line

TU162543 1.0 ml Ask for price

Lpin1 3'UTR Luciferase Stable Cell Line

TU212500 1.0 ml Ask for price

Lpin1 3'UTR GFP Stable Cell Line

TU262500 1.0 ml Ask for price

LPIN1 3'UTR GFP Stable Cell Line

TU062585 1.0 ml
EUR 2333

LPIN1 3'UTR Luciferase Stable Cell Line

TU012585 1.0 ml
EUR 2333

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

LPIN1 Rabbit Polyclonal Antibody