MCM8 Rabbit Polyclonal Antibody
MCM8 Polyclonal Antibody |
ES10748-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MCM8 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MCM8 Rabbit pAb |
A12922-100ul |
Abclonal |
100 ul |
EUR 308 |
MCM8 Rabbit pAb |
A12922-200ul |
Abclonal |
200 ul |
EUR 459 |
MCM8 Rabbit pAb |
A12922-20ul |
Abclonal |
20 ul |
EUR 183 |
MCM8 Rabbit pAb |
A12922-50ul |
Abclonal |
50 ul |
EUR 223 |
MCM8 antibody |
70R-1607 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal MCM8 antibody raised against the N terminal of MCM8 |
MCM8 antibody |
70R-18447 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MCM8 antibody |
MCM8 Antibody |
35812-100ul |
SAB |
100ul |
EUR 252 |
MCM8 Antibody |
1-CSB-PA936890 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
MCM8 Antibody |
1-CSB-PA890907LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MCM8 Antibody |
DF10122 |
Affbiotech |
200ul |
EUR 304 |
Description: MCM8 Antibody detects endogenous levels of total MCM8. |
MCM8 antibody |
70R-51404 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal MCM8 antibody |
MCM8 antibody |
70R-5551 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal MCM8 antibody raised against the N terminal of MCM8 |
MCM8 antibody |
70R-5553 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal MCM8 antibody raised against the C terminal of MCM8 |
MCM8 antibody |
70R-5605 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal MCM8 antibody raised against the N terminal of MCM8 |
MCM8 Antibody |
1-CSB-PA013598GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody |
20-abx007754 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody |
20-abx005983 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody |
20-abx214283 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody |
20-abx113762 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody |
abx145499-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody |
abx029507-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody |
abx029507-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody |
abx235063-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody |
20-abx301806 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MCM8 Conjugated Antibody |
C35812 |
SAB |
100ul |
EUR 397 |
anti- MCM8 antibody |
FNab05063 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: minichromosome maintenance complex component 8
- Uniprot ID: Q9UJA3
- Gene ID: 84515
- Research Area: Metabolism
|
Description: Antibody raised against MCM8 |
Anti-MCM8 Antibody |
PB9722 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-MCM8 antibody |
STJ114788 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the mini-chromosome maintenance proteins is a key component of the pre-replication complex and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein contains the central domain that is conserved among the mini-chromosome maintenance proteins. The encoded protein may interact with other mini-chromosome maintenance proteins and play a role in DNA replication. This gene may be associated with length of reproductive lifespan and menopause. Alternatively spliced transcript variants encoding distinct isoforms have been described. |
Anti-MCM8 antibody |
STJ191906 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MCM8 |
MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody (HRP) |
20-abx315165 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody (FITC) |
20-abx315166 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody (Biotin) |
20-abx315167 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MCM8 siRNA |
20-abx903191 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCM8 siRNA |
20-abx923743 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCM8 siRNA |
20-abx923744 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCM8 Antibody, HRP conjugated |
1-CSB-PA890907LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MCM8 Antibody, FITC conjugated |
1-CSB-PA890907LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MCM8 Antibody, Biotin conjugated |
1-CSB-PA890907LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
MCM8 Blocking Peptide |
33R-2568 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MCM8 antibody, catalog no. 70R-5551 |
MCM8 Blocking Peptide |
33R-2569 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MCM8 antibody, catalog no. 70R-1607 |
MCM8 Blocking Peptide |
33R-4137 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MCM8 antibody, catalog no. 70R-5553 |
MCM8 Blocking Peptide |
33R-7902 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MCM8 antibody, catalog no. 70R-5605 |
MCM8 cloning plasmid |
CSB-CL890907HU1-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2523
- Sequence: atgaatggagagtatagaggcagaggatttggacgaggaagatttcaaagctggaaaaggggaagaggtggtgggaacttctcaggaaaatggagagaaagagaacacagacctgatctgagtaaaaccacaggaaaacgtacttctgaacaaaccccacagtttttgctttcaa
- Show more
|
Description: A cloning plasmid for the MCM8 gene. |
MCM8 cloning plasmid |
CSB-CL890907HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1812
- Sequence: atggcttttctttgtgctgcatgtggagaaattcagagctttcctcttccagatggaaaatacagtcttcccacaaagtgtcctgtgcctgtgtgtcgaggcaggtcatttactgctctccgcagctctcctctcacagttacgatggactggcagtcaatcaaaatccaggaat
- Show more
|
Description: A cloning plasmid for the MCM8 gene. |
MCM8 cloning plasmid |
CSB-CL890907HU3-10ug |
Cusabio |
10ug |
EUR 850 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2643
- Sequence: ATGAATGGAGAGTATAGAGGCAGAGGATTTGGACGAGGAAGATTTCAAAGCTGGAAAAGGGGAAGAGGTGGTGGGAACTTCTCAGGAAAATGGAGAGAAAGAGAACACAGACCTGATCTGAGTAAAACCACAGGAAAACGTACTTCTGAACAAACCCCACAGTTTTTGCTTTCAA
- Show more
|
Description: A cloning plasmid for the MCM8 gene. |
MCM8 Blocking Peptide |
DF10122-BP |
Affbiotech |
1mg |
EUR 195 |
MCM8 Blocking Peptide |
20-abx064279 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-MCM8 (1F9) |
YF-MA19553 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MCM8 |
Human DNA replication licensing factor MCM8, MCM8 ELISA KIT |
ELI-20539h |
Lifescience Market |
96 Tests |
EUR 824 |
Human MCM8 Minichromosome Maintenance Deficient 8 (MCM8) ELISA Kit |
abx381378-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse DNA replication licensing factor MCM8, Mcm8 ELISA KIT |
ELI-38435m |
Lifescience Market |
96 Tests |
EUR 865 |
Rat MCM8 shRNA Plasmid |
20-abx988790 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MCM8 shRNA Plasmid |
20-abx975714 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MCM8 shRNA Plasmid |
20-abx963500 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mcm8 ORF Vector (Rat) (pORF) |
ORF070381 |
ABM |
1.0 ug DNA |
EUR 506 |
MCM8 ORF Vector (Human) (pORF) |
ORF006337 |
ABM |
1.0 ug DNA |
EUR 95 |
MCM8 ORF Vector (Human) (pORF) |
ORF006338 |
ABM |
1.0 ug DNA |
EUR 95 |
MCM8 ORF Vector (Human) (pORF) |
ORF013763 |
ABM |
1.0 ug DNA |
EUR 354 |
Mcm8 ORF Vector (Mouse) (pORF) |
ORF049949 |
ABM |
1.0 ug DNA |
EUR 506 |
Mcm8 sgRNA CRISPR Lentivector set (Mouse) |
K4789101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mcm8 sgRNA CRISPR Lentivector set (Rat) |
K6535701 |
ABM |
3 x 1.0 ug |
EUR 339 |
MCM8 sgRNA CRISPR Lentivector set (Human) |
K1280901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mcm8 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4789102 |
ABM |
1.0 ug DNA |
EUR 154 |
Mcm8 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4789103 |
ABM |
1.0 ug DNA |
EUR 154 |
Mcm8 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4789104 |
ABM |
1.0 ug DNA |
EUR 154 |
Mcm8 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6535702 |
ABM |
1.0 ug DNA |
EUR 154 |
Mcm8 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6535703 |
ABM |
1.0 ug DNA |
EUR 154 |
Mcm8 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6535704 |
ABM |
1.0 ug DNA |
EUR 154 |
MCM8 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1280902 |
ABM |
1.0 ug DNA |
EUR 154 |
MCM8 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1280903 |
ABM |
1.0 ug DNA |
EUR 154 |
MCM8 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1280904 |
ABM |
1.0 ug DNA |
EUR 154 |
MCM8 Protein Vector (Rat) (pPB-C-His) |
PV281522 |
ABM |
500 ng |
EUR 1166 |
MCM8 Protein Vector (Rat) (pPB-N-His) |
PV281523 |
ABM |
500 ng |
EUR 1166 |
MCM8 Protein Vector (Rat) (pPM-C-HA) |
PV281524 |
ABM |
500 ng |
EUR 1166 |
MCM8 Protein Vector (Rat) (pPM-C-His) |
PV281525 |
ABM |
500 ng |
EUR 1166 |
MCM8 Protein Vector (Mouse) (pPB-C-His) |
PV199794 |
ABM |
500 ng |
EUR 1065 |
MCM8 Protein Vector (Mouse) (pPB-N-His) |
PV199795 |
ABM |
500 ng |
EUR 1065 |
MCM8 Protein Vector (Mouse) (pPM-C-HA) |
PV199796 |
ABM |
500 ng |
EUR 1065 |
MCM8 Protein Vector (Mouse) (pPM-C-His) |
PV199797 |
ABM |
500 ng |
EUR 1065 |
MCM8 Protein Vector (Human) (pPB-C-His) |
PV055049 |
ABM |
500 ng |
EUR 481 |
MCM8 Protein Vector (Human) (pPB-N-His) |
PV055050 |
ABM |
500 ng |
EUR 481 |
MCM8 Protein Vector (Human) (pPM-C-HA) |
PV055051 |
ABM |
500 ng |
EUR 481 |
MCM8 Protein Vector (Human) (pPM-C-His) |
PV055052 |
ABM |
500 ng |
EUR 481 |
MCM8 Protein Vector (Human) (pPB-C-His) |
PV025345 |
ABM |
500 ng |
EUR 329 |
MCM8 Protein Vector (Human) (pPB-N-His) |
PV025346 |
ABM |
500 ng |
EUR 329 |
MCM8 Protein Vector (Human) (pPM-C-HA) |
PV025347 |
ABM |
500 ng |
EUR 329 |
MCM8 Protein Vector (Human) (pPM-C-His) |
PV025348 |
ABM |
500 ng |
EUR 329 |
MCM8 Protein Vector (Human) (pPB-C-His) |
PV025349 |
ABM |
500 ng |
EUR 329 |
MCM8 Protein Vector (Human) (pPB-N-His) |
PV025350 |
ABM |
500 ng |
EUR 329 |
MCM8 Protein Vector (Human) (pPM-C-HA) |
PV025351 |
ABM |
500 ng |
EUR 329 |
MCM8 Protein Vector (Human) (pPM-C-His) |
PV025352 |
ABM |
500 ng |
EUR 329 |
Mcm8 3'UTR Luciferase Stable Cell Line |
TU113002 |
ABM |
1.0 ml |
Ask for price |
Mcm8 3'UTR GFP Stable Cell Line |
TU163002 |
ABM |
1.0 ml |
Ask for price |
Mcm8 3'UTR Luciferase Stable Cell Line |
TU212968 |
ABM |
1.0 ml |
Ask for price |
Mcm8 3'UTR GFP Stable Cell Line |
TU262968 |
ABM |
1.0 ml |
Ask for price |
MCM8 3'UTR GFP Stable Cell Line |
TU063129 |
ABM |
1.0 ml |
EUR 1394 |
MCM8 3'UTR Luciferase Stable Cell Line |
TU013129 |
ABM |
1.0 ml |
EUR 1394 |
MCM8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV712227 |
ABM |
1.0 ug DNA |
EUR 316 |
MCM8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV712231 |
ABM |
1.0 ug DNA |
EUR 316 |
MCM8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV712232 |
ABM |
1.0 ug DNA |
EUR 316 |
MCM8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV712233 |
ABM |
1.0 ug DNA |
EUR 316 |
MCM8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV712237 |
ABM |
1.0 ug DNA |
EUR 316 |
MCM8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV712238 |
ABM |
1.0 ug DNA |
EUR 316 |
MCM8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV704223 |
ABM |
1.0 ug DNA |
EUR 450 |
MCM8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV704227 |
ABM |
1.0 ug DNA |
EUR 450 |
MCM8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV704228 |
ABM |
1.0 ug DNA |
EUR 450 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
MCM8 Rabbit Polyclonal Antibody