MCM8 Rabbit Polyclonal Antibody

MCM8 Rabbit Polyclonal Antibody

MCM8 Polyclonal Antibody

ABP59239-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MCM8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MCM8 from Human, Rat. This MCM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCM8 protein

MCM8 Rabbit pAb

A12922-100ul 100 ul
EUR 308

MCM8 Rabbit pAb

A12922-200ul 200 ul
EUR 459

MCM8 Rabbit pAb

A12922-20ul 20 ul
EUR 183

MCM8 Rabbit pAb

A12922-50ul 50 ul
EUR 223

MCM8 antibody

70R-51404 100 ul
EUR 244
Description: Purified Polyclonal MCM8 antibody

MCM8 antibody

70R-5551 50 ug
EUR 467
Description: Rabbit polyclonal MCM8 antibody raised against the N terminal of MCM8

MCM8 antibody

70R-5553 50 ug
EUR 467
Description: Rabbit polyclonal MCM8 antibody raised against the C terminal of MCM8

MCM8 antibody

70R-5605 50 ug
EUR 467
Description: Rabbit polyclonal MCM8 antibody raised against the N terminal of MCM8

MCM8 Antibody

ABD10122 100 ug
EUR 438

MCM8 Antibody

35812-100ul 100ul
EUR 252

MCM8 antibody

70R-18447 50 ul
EUR 435
Description: Rabbit polyclonal MCM8 antibody

MCM8 antibody

70R-1607 100 ug
EUR 377
Description: Rabbit polyclonal MCM8 antibody raised against the N terminal of MCM8

MCM8 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MCM8 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

MCM8 Antibody

DF10122 200ul
EUR 304
Description: MCM8 Antibody detects endogenous levels of total MCM8.

MCM8 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody

abx145499-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody

abx029507-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody

abx029507-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody

abx235063-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MCM8 Conjugated Antibody

C35812 100ul
EUR 397

anti- MCM8 antibody

FNab05063 100µg
EUR 548.75
  • Immunogen: minichromosome maintenance complex component 8
  • Uniprot ID: Q9UJA3
  • Gene ID: 84515
  • Research Area: Metabolism
Description: Antibody raised against MCM8

Anti-MCM8 Antibody

PB9722 100ug/vial
EUR 294

Anti-MCM8 antibody

PAab05063 100 ug
EUR 386

Anti-MCM8 antibody

STJ114788 100 µl
EUR 277
Description: The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the mini-chromosome maintenance proteins is a key component of the pre-replication complex and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein contains the central domain that is conserved among the mini-chromosome maintenance proteins. The encoded protein may interact with other mini-chromosome maintenance proteins and play a role in DNA replication. This gene may be associated with length of reproductive lifespan and menopause. Alternatively spliced transcript variants encoding distinct isoforms have been described.

Anti-MCM8 antibody

STJ191906 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MCM8

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MCM8 Minichromosome Maintenance Deficient 8 (MCM8) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MCM8 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MCM8 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MCM8 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCM8. Recognizes MCM8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MCM8 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MCM8 Blocking Peptide

33R-4137 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MCM8 antibody, catalog no. 70R-5553

MCM8 Blocking Peptide

33R-2568 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MCM8 antibody, catalog no. 70R-5551

MCM8 Blocking Peptide

33R-2569 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MCM8 antibody, catalog no. 70R-1607

MCM8 Blocking Peptide

33R-7902 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MCM8 antibody, catalog no. 70R-5605

MCM8 Blocking Peptide

DF10122-BP 1mg
EUR 195

MCM8 cloning plasmid

CSB-CL890907HU1-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2523
  • Sequence: atgaatggagagtatagaggcagaggatttggacgaggaagatttcaaagctggaaaaggggaagaggtggtgggaacttctcaggaaaatggagagaaagagaacacagacctgatctgagtaaaaccacaggaaaacgtacttctgaacaaaccccacagtttttgctttcaa
  • Show more
Description: A cloning plasmid for the MCM8 gene.

MCM8 cloning plasmid

CSB-CL890907HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1812
  • Sequence: atggcttttctttgtgctgcatgtggagaaattcagagctttcctcttccagatggaaaatacagtcttcccacaaagtgtcctgtgcctgtgtgtcgaggcaggtcatttactgctctccgcagctctcctctcacagttacgatggactggcagtcaatcaaaatccaggaat
  • Show more
Description: A cloning plasmid for the MCM8 gene.

MCM8 cloning plasmid

CSB-CL890907HU3-10ug 10ug
EUR 850
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2643
  • Show more
Description: A cloning plasmid for the MCM8 gene.

Anti-MCM8 (1F9)

YF-MA19553 100 ug
EUR 363
Description: Mouse monoclonal to MCM8

Human DNA replication licensing factor MCM8, MCM8 ELISA KIT

ELI-20539h 96 Tests
EUR 824

Mouse DNA replication licensing factor MCM8, Mcm8 ELISA KIT

ELI-38435m 96 Tests
EUR 865

Human MCM8 Minichromosome Maintenance Deficient 8 (MCM8) ELISA Kit

abx381378-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse MCM8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat MCM8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MCM8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF000701 96 Tests
EUR 689

MCM8 ORF Vector (Human) (pORF)

ORF006337 1.0 ug DNA
EUR 95

MCM8 ORF Vector (Human) (pORF)

ORF006338 1.0 ug DNA
EUR 95

Mcm8 ORF Vector (Mouse) (pORF)

ORF049949 1.0 ug DNA
EUR 506

MCM8 ORF Vector (Human) (pORF)

ORF013763 1.0 ug DNA
EUR 354

Mcm8 ORF Vector (Rat) (pORF)

ORF070381 1.0 ug DNA
EUR 506

MCM8 sgRNA CRISPR Lentivector set (Human)

K1280901 3 x 1.0 ug
EUR 339

Mcm8 sgRNA CRISPR Lentivector set (Mouse)

K4789101 3 x 1.0 ug
EUR 339

Mcm8 sgRNA CRISPR Lentivector set (Rat)

K6535701 3 x 1.0 ug
EUR 339

MCM8 sgRNA CRISPR Lentivector (Human) (Target 1)

K1280902 1.0 ug DNA
EUR 154

MCM8 sgRNA CRISPR Lentivector (Human) (Target 2)

K1280903 1.0 ug DNA
EUR 154

MCM8 sgRNA CRISPR Lentivector (Human) (Target 3)

K1280904 1.0 ug DNA
EUR 154

Mcm8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4789102 1.0 ug DNA
EUR 154

Mcm8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4789103 1.0 ug DNA
EUR 154

Mcm8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4789104 1.0 ug DNA
EUR 154

Mcm8 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6535702 1.0 ug DNA
EUR 154

Mcm8 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6535703 1.0 ug DNA
EUR 154

Mcm8 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6535704 1.0 ug DNA
EUR 154

MCM8 Protein Vector (Human) (pPB-C-His)

PV055049 500 ng
EUR 481

MCM8 Protein Vector (Human) (pPB-N-His)

PV055050 500 ng
EUR 481

MCM8 Protein Vector (Human) (pPM-C-HA)

PV055051 500 ng
EUR 481

MCM8 Protein Vector (Human) (pPM-C-His)

PV055052 500 ng
EUR 481

MCM8 Protein Vector (Rat) (pPB-C-His)

PV281522 500 ng
EUR 1166

MCM8 Protein Vector (Rat) (pPB-N-His)

PV281523 500 ng
EUR 1166

MCM8 Protein Vector (Rat) (pPM-C-HA)

PV281524 500 ng
EUR 1166

MCM8 Protein Vector (Rat) (pPM-C-His)

PV281525 500 ng
EUR 1166

MCM8 Protein Vector (Human) (pPB-C-His)

PV025345 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPB-N-His)

PV025346 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPM-C-HA)

PV025347 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPM-C-His)

PV025348 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPB-C-His)

PV025349 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPB-N-His)

PV025350 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPM-C-HA)

PV025351 500 ng
EUR 329

MCM8 Protein Vector (Human) (pPM-C-His)

PV025352 500 ng
EUR 329

MCM8 Protein Vector (Mouse) (pPB-C-His)

PV199794 500 ng
EUR 1065

MCM8 Protein Vector (Mouse) (pPB-N-His)

PV199795 500 ng
EUR 1065

MCM8 Protein Vector (Mouse) (pPM-C-HA)

PV199796 500 ng
EUR 1065

MCM8 Protein Vector (Mouse) (pPM-C-His)

PV199797 500 ng
EUR 1065

Mcm8 3'UTR GFP Stable Cell Line

TU163002 1.0 ml Ask for price

Mcm8 3'UTR Luciferase Stable Cell Line

TU212968 1.0 ml Ask for price

MCM8 3'UTR Luciferase Stable Cell Line

TU013129 1.0 ml
EUR 1394

Mcm8 3'UTR Luciferase Stable Cell Line

TU113002 1.0 ml Ask for price

MCM8 3'UTR GFP Stable Cell Line

TU063129 1.0 ml
EUR 1394

Mcm8 3'UTR GFP Stable Cell Line

TU262968 1.0 ml Ask for price

MCM8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV704223 1.0 ug DNA
EUR 450

MCM8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV704227 1.0 ug DNA
EUR 450

MCM8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV704228 1.0 ug DNA
EUR 450

MCM8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV712227 1.0 ug DNA
EUR 316

MCM8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV712231 1.0 ug DNA
EUR 316

MCM8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV712232 1.0 ug DNA
EUR 316

MCM8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV712233 1.0 ug DNA
EUR 316

MCM8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV712237 1.0 ug DNA
EUR 316

MCM8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV712238 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MCM8 Rabbit Polyclonal Antibody