MED20 Rabbit Polyclonal Antibody

MED20 Rabbit Polyclonal Antibody

MED20 Polyclonal Antibody

ES10655-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MED20 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MED20 Polyclonal Antibody

ES10655-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MED20 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MED20 Rabbit pAb

A15757-100ul 100 ul
EUR 308

MED20 Rabbit pAb

A15757-200ul 200 ul
EUR 459

MED20 Rabbit pAb

A15757-20ul 20 ul
EUR 183

MED20 Rabbit pAb

A15757-50ul 50 ul
EUR 223

MED20 antibody

70R-18464 50 ul
EUR 435
Description: Rabbit polyclonal MED20 antibody

MED20 Antibody

44785-100ul 100ul
EUR 252

MED20 Antibody

44785-50ul 50ul
EUR 187

MED20 Antibody

1-CSB-PA862046LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED20. Recognizes MED20 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MED20 Antibody

DF2472 200ul
EUR 304
Description: MED20 antibody detects endogenous levels of total MED20.

MED20 Antibody

1-CSB-PA013653GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MED20. Recognizes MED20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MED20 Antibody

ABD2472 100 ug
EUR 438

MED20 Conjugated Antibody

C44785 100ul
EUR 397

anti- MED20 antibody

FNab05092 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200 - 1:2000
  • Immunogen: mediator complex subunit 20
  • Uniprot ID: Q9H944
  • Gene ID: 9477
  • Research Area: Metabolism
Description: Antibody raised against MED20

Anti-MED20 antibody

PAab05092 100 ug
EUR 355

Anti-MED20 antibody

STJ118216 100 µl
EUR 277

Anti-MED20 antibody

STJ191813 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MED20

Med20/ Rat Med20 ELISA Kit

ELI-36453r 96 Tests
EUR 886

MED20 Protein

20-abx260940
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

MED20 siRNA

20-abx903206
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED20 siRNA

20-abx923849
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED20 siRNA

20-abx923850
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-TRFP/MED20 Antibody

A09407-1 100ug/vial
EUR 294

Human TRFP/MED20 Antibody

33413-05111 150 ug
EUR 276

MED20 Antibody, HRP conjugated

1-CSB-PA862046LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED20. Recognizes MED20 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MED20 Antibody, FITC conjugated

1-CSB-PA862046LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED20. Recognizes MED20 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MED20 Antibody, Biotin conjugated

1-CSB-PA862046LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED20. Recognizes MED20 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MED20 Blocking Peptide

DF2472-BP 1mg
EUR 195

MED20 cloning plasmid

CSB-CL862046HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 639
  • Sequence: atgggagtgacttgtgtgtcccagatgcctgtggccgagggcaagagtgttcagcaaaccgtagagctccttacccggaaattggagatgcttggggcagagaagcaaggaacattttgtgtggactgtgagacttaccatacggccgcctctacccttggcagccaaggtcagac
  • Show more
Description: A cloning plasmid for the MED20 gene.

anti-TRFP / MED20

YF-PA16338 50 ug
EUR 363
Description: Mouse polyclonal to TRFP / MED20

Human TRFP/MED20 Antibody (Biotin Conjugate)

33413-05121 150 ug
EUR 369

Mediator Complex Subunit 20 (MED20) Antibody

20-abx215787
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 20 (MED20) Antibody

20-abx113641
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 20 (MED20) Antibody

abx235092-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Mediator Complex Subunit 20 (MED20) Antibody

20-abx313804
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MED20 protein (His tag)

30R-2919 100 ug
EUR 322
Description: Purified recombinant Human MED20 protein (His tag)

Mouse Med20 ELISA KIT

ELI-15749m 96 Tests
EUR 865

Chicken MED20 ELISA KIT

ELI-16350c 96 Tests
EUR 928

Human MED20 ELISA KIT

ELI-31329h 96 Tests
EUR 824

MED20 ELISA KIT|Human

EF000726 96 Tests
EUR 689

Rat MED20 shRNA Plasmid

20-abx989937
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MED20 Rabbit Polyclonal Antibody