MIXL1 Rabbit Polyclonal Antibody

MIXL1 Rabbit Polyclonal Antibody

MIXL1 Rabbit pAb
A17223-100ul 100 ul
EUR 308

MIXL1 Rabbit pAb
A17223-200ul 200 ul
EUR 459

MIXL1 Rabbit pAb
A17223-20ul 20 ul
EUR 183

MIXL1 Rabbit pAb
A17223-50ul 50 ul
EUR 223

Polyclonal MIXL1 Antibody (Center)
APR04413G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MIXL1 (Center). This antibody is tested and proven to work in the following applications:

Homeobox Protein MIXL1 (MIXL1) Antibody
20-abx215957
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Homeobox Protein MIXL1 (MIXL1) Antibody
abx030906-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Homeobox Protein MIXL1 (MIXL1) Antibody
abx030906-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Homeobox Protein MIXL1 (MIXL1) Antibody
abx235200-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

MIXL1 Antibody
44781-100ul 100ul
EUR 252

MIXL1 Antibody
44781-50ul 50ul
EUR 187

MIXL1 Antibody
DF2467 200ul
EUR 304
Description: MIXL1 antibody detects endogenous levels of total MIXL1.

MIXL1 Antibody
ABD2467 100 ug
EUR 438

Polyclonal MIXL1 Antibody (C-term)
APR04752G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MIXL1 (C-term). This antibody is tested and proven to work in the following applications:

MIXL1 Conjugated Antibody
C44781 100ul
EUR 397

anti- MIXL1 antibody
FNab05200 100µg
EUR 505.25
  • Immunogen: Mix1 homeobox-like 1(Xenopus laevis)
  • Uniprot ID: Q9H2W2
  • Gene ID: 83881
  • Research Area: Stem Cells, Metabolism, Developmental biology
Description: Antibody raised against MIXL1

Anti-MIXL1 antibody
PAab05200 100 ug
EUR 355

Anti-MIXL1 antibody
STJ119398 100 µl
EUR 277

Anti-MIXL1 antibody
STJ191807 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MIXL1

MIXL1 siRNA
20-abx924201
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MIXL1 siRNA
20-abx924202
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Mouse Homeobox protein MIXL1, Mixl1 ELISA KIT
ELI-19521m 96 Tests
EUR 865

Human Homeobox protein MIXL1, MIXL1 ELISA KIT
ELI-23040h 96 Tests
EUR 824

Mouse Homeobox protein MIXL1 (MIXL1) ELISA Kit
abx389910-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

MIXL1 Blocking Peptide
DF2467-BP 1mg
EUR 195

MIXL1 cloning plasmid
CSB-CL887966HU-10ug 10ug
EUR 306
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 699
  • Sequence: ATGGCCACAGCCGAGTCCCGTGCGCTCCAGTTTGCCGAGGGCGCCGCGTTTCCAGCGTACCGGGCCCCCCACGCCGGCGGGGCGCTCCTGCCGCCCCCGAGCCCTGCGGCAGCCCTGCTCCCTGCGCCGCCCGCGGGCCCCGGCCCAGCGACCTTTGCGGGCTTCCTCGGCCGGGA
  • Show more
Description: A cloning plasmid for the MIXL1 gene.

Anti-Mixl1 (4D11)
YF-MA19491 100 ug
EUR 363
Description: Mouse monoclonal to Mixl1

Mixl1 ELISA Kit| Mouse Homeobox protein MIXL1 ELISA Kit
EF015549 96 Tests
EUR 689

MIXL1 ELISA KIT|Human
EF000804 96 Tests
EUR 689

Mouse MIXL1 shRNA Plasmid
20-abx973844
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MIXL1 shRNA Plasmid
20-abx963220
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MIXL1 Recombinant Protein (Human)
RP041344 100 ug Ask for price

MIXL1 Recombinant Protein (Mouse)
RP150734 100 ug Ask for price

MIXL1 Recombinant Protein (Rat)
RP211814 100 ug Ask for price

Recombinant human Homeobox protein MIXL1
P2275 100ug Ask for price
  • Uniprot ID: Q9H2W2
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Homeobox protein MIXL1

Mixl1 ORF Vector (Rat) (pORF)
ORF070606 1.0 ug DNA
EUR 506

MIXL1 Rabbit Polyclonal Antibody