NEU2 Rabbit Polyclonal Antibody
 NEU2 Polyclonal Antibody |
|
31445-100ul |
SAB |
100ul |
EUR 252 |
NEU2 Polyclonal Antibody |
|
31445-50ul |
SAB |
50ul |
EUR 187 |
 NEU2 Rabbit pAb |
|
A8137-100ul |
Abclonal |
100 ul |
EUR 308 |
NEU2 Rabbit pAb |
|
A8137-200ul |
Abclonal |
200 ul |
EUR 459 |
NEU2 Rabbit pAb |
|
A8137-20ul |
Abclonal |
20 ul |
EUR 183 |
NEU2 Rabbit pAb |
|
A8137-50ul |
Abclonal |
50 ul |
EUR 223 |
 NEU2 Polyclonal Conjugated Antibody |
|
C31445 |
SAB |
100ul |
EUR 397 |
 NEU2 antibody |
|
10R-4959 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal NEU2 antibody |
NEU2 antibody |
|
10R-4960 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal NEU2 antibody |
NEU2 antibody |
|
10R-4961 |
Fitzgerald |
100 ul |
EUR 726 |
|
Description: Mouse monoclonal NEU2 antibody |
 NEU2 Antibody |
|
1-CSB-PA896716ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against NEU2. Recognizes NEU2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
) Polyclonal NEU2 Antibody (N-term) |
|
APR17547G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEU2 (N-term). This antibody is tested and proven to work in the following applications: |
 Anti-NEU2 antibody |
|
STJ110436 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene belongs to a family of glycohydrolytic enzymes which remove sialic acid residues from glycoproteins and glycolipids. Expression studies in COS7 cells confirmed that this gene encodes a functional sialidase. Its cytosolic localization was demonstrated by cell fractionation experiments. |
Anti-NEU2 antibody |
|
STJ192080 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to NEU2 |
 NEU2 siRNA |
|
20-abx925757 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NEU2 siRNA |
|
20-abx925758 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-NEU2 |
|
YF-PA24230 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to NEU2 |
 Antibody) Sialidase-2 (NEU2) Antibody |
|
20-abx005702 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Sialidase-2 (NEU2) Antibody |
|
abx026645-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Sialidase-2 (NEU2) Antibody |
|
abx026645-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Sialidase-2 (NEU2) Antibody |
|
20-abx321070 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 NEU2 cloning plasmid |
|
CSB-CL896716HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1143
- Sequence: ATGGCGTCCCTTCCTGTCCTGCAGAAGGAGAGCGTGTTCCAGTCGGGAGCCCATGCCTACAGAATCCCTGCCCTGCTCTACCTGCCTGGGCAGCAGTCCCTGCTGGCCTTCGCGGAACAGCGGGCAAGCAAGAAGGATGAGCACGCAGAGCTGATTGTCCTGCGCAGAGGAGACT
- Show more
|
|
Description: A cloning plasmid for the NEU2 gene. |
) Anti-NEU2 (3G9) |
|
YF-MA14415 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to NEU2 |
) Anti-NEU2 (2E5) |
|
YF-MA14416 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to NEU2 |
) Anti-NEU2 (3B9) |
|
YF-MA10617 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to NEU2 |
 Mouse NEU2 shRNA Plasmid |
|
20-abx973573 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human NEU2 shRNA Plasmid |
|
20-abx953159 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) NEU2 Recombinant Protein (Human) |
|
RP041617 |
ABM |
100 ug |
Ask for price |
) NEU2 Recombinant Protein (Rat) |
|
RP213713 |
ABM |
100 ug |
Ask for price |
) NEU2 Recombinant Protein (Mouse) |
|
RP153731 |
ABM |
100 ug |
Ask for price |
NEU2 Recombinant Protein (Mouse) |
|
RP153734 |
ABM |
100 ug |
Ask for price |
NEU2 Recombinant Protein (Mouse) |
|
RP153737 |
ABM |
100 ug |
Ask for price |
NEU2 Recombinant Protein (Mouse) |
|
RP153740 |
ABM |
100 ug |
Ask for price |
 (M02), Clone: 3G9) Monoclonal NEU2 Antibody (monoclonal) (M02), Clone: 3G9 |
|
APR17545G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human NEU2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3G9. This antibody is applicable in E |
 (M04), Clone: 2E6) Monoclonal NEU2 Antibody (monoclonal) (M04), Clone: 2E6 |
|
APR17546G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human NEU2 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 2E6. This antibody is applicable in WB, E |
 (pORF)) Neu2 ORF Vector (Rat) (pORF) |
|
ORF071239 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) NEU2 ORF Vector (Human) (pORF) |
|
ORF013873 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Neu2 ORF Vector (Mouse) (pORF) |
|
ORF051245 |
ABM |
1.0 ug DNA |
EUR 506 |
Neu2 ORF Vector (Mouse) (pORF) |
|
ORF051246 |
ABM |
1.0 ug DNA |
EUR 506 |
Neu2 ORF Vector (Mouse) (pORF) |
|
ORF051247 |
ABM |
1.0 ug DNA |
EUR 506 |
Neu2 ORF Vector (Mouse) (pORF) |
|
ORF051248 |
ABM |
1.0 ug DNA |
EUR 506 |
) NEU2 sgRNA CRISPR Lentivector set (Human) |
|
K1418401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Neu2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3003301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Neu2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3418801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Neu2 sgRNA CRISPR Lentivector set (Rat) |
|
K6762601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) NEU2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1418402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) NEU2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1418403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) NEU2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1418404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Neu2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3003302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Neu2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3003303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Neu2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3003304 |
ABM |
1.0 ug DNA |
EUR 154 |
Neu2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3418802 |
ABM |
1.0 ug DNA |
EUR 154 |
Neu2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3418803 |
ABM |
1.0 ug DNA |
EUR 154 |
Neu2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3418804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Neu2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6762602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Neu2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6762603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Neu2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6762604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) NEU2 Protein Vector (Human) (pPB-C-His) |
|
PV055489 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) NEU2 Protein Vector (Human) (pPB-N-His) |
|
PV055490 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) NEU2 Protein Vector (Human) (pPM-C-HA) |
|
PV055491 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) NEU2 Protein Vector (Human) (pPM-C-His) |
|
PV055492 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) NEU2 Protein Vector (Rat) (pPB-C-His) |
|
PV284954 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NEU2 Protein Vector (Rat) (pPB-N-His) |
|
PV284955 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NEU2 Protein Vector (Rat) (pPM-C-HA) |
|
PV284956 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NEU2 Protein Vector (Rat) (pPM-C-His) |
|
PV284957 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) NEU2 Protein Vector (Mouse) (pPB-C-His) |
|
PV204978 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NEU2 Protein Vector (Mouse) (pPB-N-His) |
|
PV204979 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NEU2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV204980 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NEU2 Protein Vector (Mouse) (pPM-C-His) |
|
PV204981 |
ABM |
500 ng |
EUR 603 |
NEU2 Protein Vector (Mouse) (pPB-C-His) |
|
PV204982 |
ABM |
500 ng |
EUR 603 |
NEU2 Protein Vector (Mouse) (pPB-N-His) |
|
PV204983 |
ABM |
500 ng |
EUR 603 |
NEU2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV204984 |
ABM |
500 ng |
EUR 603 |
NEU2 Protein Vector (Mouse) (pPM-C-His) |
|
PV204985 |
ABM |
500 ng |
EUR 603 |
NEU2 Protein Vector (Mouse) (pPB-C-His) |
|
PV204986 |
ABM |
500 ng |
EUR 603 |
NEU2 Protein Vector (Mouse) (pPB-N-His) |
|
PV204987 |
ABM |
500 ng |
EUR 603 |
NEU2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV204988 |
ABM |
500 ng |
EUR 603 |
NEU2 Protein Vector (Mouse) (pPM-C-His) |
|
PV204989 |
ABM |
500 ng |
EUR 603 |
NEU2 Protein Vector (Mouse) (pPB-C-His) |
|
PV204990 |
ABM |
500 ng |
EUR 603 |
NEU2 Protein Vector (Mouse) (pPB-N-His) |
|
PV204991 |
ABM |
500 ng |
EUR 603 |
NEU2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV204992 |
ABM |
500 ng |
EUR 603 |
NEU2 Protein Vector (Mouse) (pPM-C-His) |
|
PV204993 |
ABM |
500 ng |
EUR 603 |
 Neu2 3'UTR GFP Stable Cell Line |
|
TU164006 |
ABM |
1.0 ml |
Ask for price |
 Neu2 3'UTR Luciferase Stable Cell Line |
|
TU213901 |
ABM |
1.0 ml |
Ask for price |
 NEU2 3'UTR Luciferase Stable Cell Line |
|
TU015591 |
ABM |
1.0 ml |
EUR 2333 |
Neu2 3'UTR Luciferase Stable Cell Line |
|
TU114006 |
ABM |
1.0 ml |
Ask for price |
 NEU2 3'UTR GFP Stable Cell Line |
|
TU065591 |
ABM |
1.0 ml |
EUR 2333 |
Neu2 3'UTR GFP Stable Cell Line |
|
TU263901 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) NEU2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV667909 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) NEU2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV667913 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) NEU2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV667914 |
ABM |
1.0 ug DNA |
EUR 682 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
NEU2 Rabbit Polyclonal Antibody
