NFE2 Rabbit Polyclonal Antibody

NFE2 Rabbit Polyclonal Antibody

NFE2 Polyclonal Antibody

ABP59454-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NFE2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NFE2 from Human, Mouse, Rat. This NFE2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NFE2 protein

NFE2 Polyclonal Antibody

ES10767-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NFE2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NFE2 Polyclonal Antibody

ES10767-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NFE2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NFE2 antibody

70R-18854 50 ul
EUR 435
Description: Rabbit polyclonal NFE2 antibody

NFE2 Antibody

44859-100ul 100ul
EUR 252

NFE2 Antibody

44859-50ul 50ul
EUR 187

NFE2 Antibody

DF2595 200ul
EUR 304
Description: NFE2 antibody detects endogenous levels of total NFE2.

NFE2 Antibody

1-CSB-PA015750GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NFE2. Recognizes NFE2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

NFE2 Antibody

ABD2595 100 ug
EUR 438

Nfe2/ Rat Nfe2 ELISA Kit

ELI-44059r 96 Tests
EUR 886

NFE2 Conjugated Antibody

C44859 100ul
EUR 397

anti- NFE2 antibody

FNab05692 100µg
EUR 585
  • Immunogen: nuclear factor(erythroid-derived 2), 45kDa
  • Uniprot ID: Q16621
  • Gene ID: 4778
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against NFE2

Anti-NFE2 antibody

PAab05692 100 ug
EUR 412

Anti-NFE2 antibody

STJ191925 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NFE2

NFE2 siRNA

20-abx903545
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NFE2 siRNA

20-abx925812
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NFE2 siRNA

20-abx925813
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NFE2 Blocking Peptide

DF2595-BP 1mg
EUR 195

NFE2 cloning plasmid

CSB-CL618088HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1122
  • Sequence: atgtccccgtgtcctccccagcagagcaggaacagggtgatacagctgtccacttcagagctaggagagatggaactgacttggcaggagatcatgtccatcaccgagctgcagggtctgaatgctccaagtgagccatcatttgagccccaagccccagctccataccttggac
  • Show more
Description: A cloning plasmid for the NFE2 gene.

Bovine NFE2 ELISA KIT

ELI-15004b 96 Tests
EUR 928

NFE2 ELISA KIT|Human

EF001202 96 Tests
EUR 689

Rat NFE2 shRNA Plasmid

20-abx990678
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NFE2 shRNA Plasmid

20-abx971721
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NFE2 shRNA Plasmid

20-abx953170
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NFE2 Rabbit Polyclonal Antibody