RAD9B Rabbit Polyclonal Antibody
 RAD9B Polyclonal Antibody |
|
ABP60079-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RAD9B protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RAD9B from Human. This RAD9B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAD9B protein |
RAD9B Polyclonal Antibody |
|
ABP60079-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RAD9B protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RAD9B from Human. This RAD9B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAD9B protein |
RAD9B Polyclonal Antibody |
|
ABP60079-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RAD9B protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RAD9B from Human. This RAD9B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAD9B protein |
RAD9B Polyclonal Antibody |
|
A68947 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: kits suitable for this type of research |
 RAD9B antibody |
|
70R-5622 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal RAD9B antibody |
 RAD9B Antibody |
|
44726-100ul |
SAB |
100ul |
EUR 252 |
RAD9B Antibody |
|
44726-50ul |
SAB |
50ul |
EUR 187 |
RAD9B Antibody |
|
DF2365 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RAD9B antibody detects endogenous levels of total RAD9B. |
RAD9B Antibody |
|
1-CSB-PA740946LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAD9B. Recognizes RAD9B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
 RAD9B Polyclonal Antibody, HRP Conjugated |
|
A68948 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: fast delivery possible |
 RAD9B Polyclonal Antibody, FITC Conjugated |
|
A68949 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: reagents widely cited |
 RAD9B Polyclonal Antibody, Biotin Conjugated |
|
A68950 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: Ask the seller for details |
 ELISA kit) Rabbit Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E04C2415-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E04C2415-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E04C2415-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 RAD9B Conjugated Antibody |
|
C44726 |
SAB |
100ul |
EUR 397 |
 Anti-RAD9B antibody |
|
STJ191722 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RAD9B |
 RAD9B siRNA |
|
20-abx904449 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAD9B siRNA |
|
20-abx930792 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAD9B siRNA |
|
20-abx930793 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 RAD9B Antibody, HRP conjugated |
|
1-CSB-PA740946LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAD9B. Recognizes RAD9B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 RAD9B Antibody, FITC conjugated |
|
1-CSB-PA740946LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAD9B. Recognizes RAD9B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 RAD9B Antibody, Biotin conjugated |
|
1-CSB-PA740946LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAD9B. Recognizes RAD9B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 RAD9B Blocking Peptide |
|
33R-8859 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD9B antibody, catalog no. 70R-5622 |
RAD9B Blocking Peptide |
|
DF2365-BP |
Affbiotech |
1mg |
EUR 195 |
 RAD9B cloning plasmid |
|
CSB-CL740946HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 816
- Sequence: atgattcaaccaagattgcttgctgatgccattgttctttttacatcaagtcaagaggaagttactcttgctgttactccactgaatttttgcctcaagagttctaatgaggaatcaatggatttgagcaatgctgtacacagtgagatgtttgttggctcagatgagtttgactt
- Show more
|
|
Description: A cloning plasmid for the RAD9B gene. |
RAD9B cloning plasmid |
|
CSB-CL740946HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 780
- Sequence: ATGATTCAACCAAGATTGCTTGCTGATGCCATTGTTCTTTTTACATCAAGTCAAGAGGAAGTTACTCTTGCTGTTACTCCACTGAATTTTTGCCTCAAGAGTTCTAATGAGGAATCAATGGATTTGAGCAATGCTGTACACAGTGAGATGTTTGTTGGCTCAGATGAGTTTGACTT
- Show more
|
|
Description: A cloning plasmid for the RAD9B gene. |
 ELISA kit) Goat Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E06C2415-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E06C2415-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E06C2415-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Goat Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Human Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E01C2415-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E01C2415-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E01C2415-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Human Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Rat Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E02C2415-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E02C2415-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E02C2415-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rat Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Mouse Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E03C2415-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E03C2415-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E03C2415-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Dog Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E08C2415-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E08C2415-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E08C2415-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Canine Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Monkey Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E09C2415-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E09C2415-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E09C2415-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Pig Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E07C2415-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E07C2415-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E07C2415-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human RAD9B shRNA Plasmid |
|
20-abx965417 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat RAD9B shRNA Plasmid |
|
20-abx990568 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse RAD9B shRNA Plasmid |
|
20-abx981906 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) RAD9B Recombinant Protein (Human) |
|
RP025669 |
ABM |
100 ug |
Ask for price |
RAD9B Recombinant Protein (Human) |
|
RP042703 |
ABM |
100 ug |
Ask for price |
) RAD9B Recombinant Protein (Rat) |
|
RP223499 |
ABM |
100 ug |
Ask for price |
) RAD9B Recombinant Protein (Mouse) |
|
RP166544 |
ABM |
100 ug |
Ask for price |
 ELISA kit) Guinea pig Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E05C2415-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E05C2415-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Cell cycle checkpoint control protein RAD9B(RAD9B) ELISA kit |
|
E05C2415-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cell cycle checkpoint control protein RAD9B(RAD9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) RAD9 Checkpoint Clamp Component B (RAD9B) Antibody |
|
20-abx149205 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAD9 Checkpoint Clamp Component B (RAD9B) Antibody |
|
20-abx338644 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) RAD9B ORF Vector (Human) (pORF) |
|
ORF008557 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Rad9b ORF Vector (Rat) (pORF) |
|
ORF074501 |
ABM |
1.0 ug DNA |
EUR 506 |
RAD9B ORF Vector (Human) (pORF) |
|
ORF014235 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Rad9b ORF Vector (Mouse) (pORF) |
|
ORF055516 |
ABM |
1.0 ug DNA |
EUR 506 |
 Antibody (HRP)) RAD9 Checkpoint Clamp Component B (RAD9B) Antibody (HRP) |
|
20-abx335040 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) RAD9 Checkpoint Clamp Component B (RAD9B) Antibody (FITC) |
|
20-abx335041 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) RAD9 Checkpoint Clamp Component B (RAD9B) Antibody (Biotin) |
|
20-abx335042 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) RAD9B sgRNA CRISPR Lentivector set (Human) |
|
K1778101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rad9b sgRNA CRISPR Lentivector set (Rat) |
|
K7567201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rad9b sgRNA CRISPR Lentivector set (Mouse) |
|
K4840501 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) RAD9B sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1778102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) RAD9B sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1778103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) RAD9B sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1778104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rad9b sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7567202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rad9b sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7567203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rad9b sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7567204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rad9b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4840502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rad9b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4840503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rad9b sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4840504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) RAD9B Protein Vector (Human) (pPB-C-His) |
|
PV056937 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) RAD9B Protein Vector (Human) (pPB-N-His) |
|
PV056938 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) RAD9B Protein Vector (Human) (pPM-C-HA) |
|
PV056939 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) RAD9B Protein Vector (Human) (pPM-C-His) |
|
PV056940 |
ABM |
500 ng |
EUR 481 |
RAD9B Protein Vector (Human) (pPB-C-His) |
|
PV034225 |
ABM |
500 ng |
EUR 329 |
RAD9B Protein Vector (Human) (pPB-N-His) |
|
PV034226 |
ABM |
500 ng |
EUR 329 |
RAD9B Protein Vector (Human) (pPM-C-HA) |
|
PV034227 |
ABM |
500 ng |
EUR 329 |
RAD9B Protein Vector (Human) (pPM-C-His) |
|
PV034228 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) RAD9B Protein Vector (Rat) (pPB-C-His) |
|
PV298002 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) RAD9B Protein Vector (Rat) (pPB-N-His) |
|
PV298003 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) RAD9B Protein Vector (Rat) (pPM-C-HA) |
|
PV298004 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) RAD9B Protein Vector (Rat) (pPM-C-His) |
|
PV298005 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) RAD9B Protein Vector (Mouse) (pPB-C-His) |
|
PV222062 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) RAD9B Protein Vector (Mouse) (pPB-N-His) |
|
PV222063 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) RAD9B Protein Vector (Mouse) (pPM-C-HA) |
|
PV222064 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) RAD9B Protein Vector (Mouse) (pPM-C-His) |
|
PV222065 |
ABM |
500 ng |
EUR 603 |
 Rad9b 3'UTR GFP Stable Cell Line |
|
TU167483 |
ABM |
1.0 ml |
Ask for price |
 RAD9B 3'UTR Luciferase Stable Cell Line |
|
TU019431 |
ABM |
1.0 ml |
EUR 2333 |
 Rad9b 3'UTR Luciferase Stable Cell Line |
|
TU117483 |
ABM |
1.0 ml |
Ask for price |
 RAD9B 3'UTR GFP Stable Cell Line |
|
TU069431 |
ABM |
1.0 ml |
EUR 2333 |
Rad9b 3'UTR GFP Stable Cell Line |
|
TU267260 |
ABM |
1.0 ml |
Ask for price |
Rad9b 3'UTR Luciferase Stable Cell Line |
|
TU217260 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) RAD9B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV639229 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) RAD9B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV639233 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) RAD9B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV639234 |
ABM |
1.0 ug DNA |
EUR 682 |
 (CMV) (pLenti-GIII-CMV)) RAD9B Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV705561 |
ABM |
1.0 ug DNA |
EUR 450 |
 (UbC) (pLenti-GIII-UbC)) RAD9B Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV705565 |
ABM |
1.0 ug DNA |
EUR 450 |
 (EF1a) (pLenti-GIII-EF1a)) RAD9B Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV705566 |
ABM |
1.0 ug DNA |
EUR 450 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
RAD9B Rabbit Polyclonal Antibody
