SGK3 Rabbit Polyclonal Antibody

SGK3 Rabbit Polyclonal Antibody

SGK3 Polyclonal Antibody

ABP60385-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SGK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SGK3 from Human, Mouse, Rat. This SGK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGK3 protein

SGK3 Polyclonal Antibody

ABP60385-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SGK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SGK3 from Human, Mouse, Rat. This SGK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGK3 protein

SGK3 Polyclonal Antibody

ABP60385-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SGK3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SGK3 from Human, Mouse, Rat. This SGK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGK3 protein

SGK3 Polyclonal Antibody

30974-100ul 100ul
EUR 252

SGK3 Polyclonal Antibody

30974-50ul 50ul
EUR 187

SGK3 Rabbit pAb

A7586-100ul 100 ul
EUR 308

SGK3 Rabbit pAb

A7586-200ul 200 ul
EUR 459

SGK3 Rabbit pAb

A7586-20ul 20 ul
EUR 183

SGK3 Rabbit pAb

A7586-50ul 50 ul
EUR 223

Polyclonal SGK3 Antibody (Center)

APR07174G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SGK3 (Center). This antibody is tested and proven to work in the following applications:

SGK3 Polyclonal Conjugated Antibody

C30974 100ul
EUR 397

Rabbit Anti Human Sgk3 (C-Terminal) Polyclonal Antibody

CPBT-67608RH 50 µg
EUR 985

SGK3 Antibody

AF7930 200ul
EUR 376
Description: SGK3 Antibody detects endogenous levels of SGK3.

SGK3 antibody

70R-5846 50 ug
EUR 467
Description: Rabbit polyclonal SGK3 antibody raised against the N terminal of SGK3

Sgk3 antibody

70R-9338 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Sgk3 antibody

SGK3 Antibody

ABD2679 100 ug
EUR 438

SGK3 Antibody

35428-100ul 100ul
EUR 390

SGK3 antibody

20R-SR029 50 ug
EUR 656
Description: Rabbit polyclonal SGK3 antibody

SGK3 antibody

20R-SR030 50 ug
EUR 656
Description: Rabbit polyclonal SGK3 antibody

SGK3 antibody

70R-20226 50 ul
EUR 435
Description: Rabbit polyclonal SGK3 antibody

SGK3 Antibody

DF2679 200ul
EUR 304
Description: SGK3 antibody detects endogenous levels of total SGK3.

SGK3 Antibody

1-CSB-PA839296ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SGK3. Recognizes SGK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SGK3 Antibody

1-CSB-PA021191GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SGK3. Recognizes SGK3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal SGK3 Antibody (N-term)

APR07040G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SGK3 (N-term). This antibody is tested and proven to work in the following applications:

Serine/threonine-Protein Kinase Sgk3 (Sgk3) Antibody

abx027950-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase Sgk3 (Sgk3) Antibody

abx027950-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sgk3/ Rat Sgk3 ELISA Kit

ELI-19204r 96 Tests
EUR 886

anti- SGK3 antibody

FNab07808 100µg
EUR 548.75
  • Immunogen: serum/glucocorticoid regulated kinase family, member 3
  • Uniprot ID: Q96BR1
  • Gene ID: 23678
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against SGK3

Anti-SGK3 antibody

PAab07808 100 ug
EUR 386

Anti-SGK3 antibody

STJ29723 100 µl
EUR 277
Description: This gene is a member of the Ser/Thr protein kinase family and encodes a phosphoprotein with a PX (phox homology) domain. The protein phosphorylates several target proteins and has a role in neutral amino acid transport and activation of potassium and chloride channels. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

Anti-SGK3 antibody

STJ191987 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SGK3

SGK3 siRNA

20-abx933167
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SGK3 siRNA

20-abx933168
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-SGK3 (Thr320) Antibody

AF2402 200ul
EUR 304
Description: Phospho-SGK3 (Thr320) Antibody detects endogenous levels of SGK3 only when phosphorylated at T320._x000D__x000D_

Phospho-SGK3 (Ser486) Antibody

AF7430 200ul
EUR 376
Description: Phospho-SGK3 (Ser486) Antibody detects endogenous levels of SGK3 only when phosphorylated at Ser486.

Phospho- SGK3 (Thr320) Antibody

ABF3738 100 ug
EUR 438

SGK3 (Phospho-Ser486) Antibody

13272-100ul 100ul
EUR 252

SGK3 (Phospho-Ser486) Antibody

13272-50ul 50ul
EUR 187

Anti-C8orf44-SGK3 Antibody

STJ502984 100 µg
EUR 476

SGK3 Blocking Peptide

AF7930-BP 1mg
EUR 195

SGK3 Blocking Peptide

33R-5569 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SGK3 antibody, catalog no. 70R-5846

Sgk3 Blocking Peptide

33R-9416 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Sgk3 antibody, catalog no. 70R-9338

SGK3 Blocking Peptide

DF2679-BP 1mg
EUR 195

SGK3 cloning plasmid

CSB-CL839296HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1491
  • Sequence: atgcaaagagatcacaccatggactacaaggaaagctgcccaagtgtaagcattcccagctccgatgaacacagagagaaaaagaagaggtttactgtttataaagttctggtttcagtgggaagaagtgaatggtttgtcttcaggagatatgcagagtttgataaactttata
  • Show more
Description: A cloning plasmid for the SGK3 gene.

Anti-SGK3 (2A7)

YF-MA11415 100 ug
EUR 363
Description: Mouse monoclonal to SGK3

SGK3 (Phospho-Ser486) Conjugated Antibody

C13272 100ul
EUR 397

Anti-C8orf44-SGK3 Antibody (Biotin)

STJ502985 100 µg
EUR 586

Anti-C8orf44-SGK3 Antibody (FITC)

STJ502986 100 µg
EUR 586

Human Serine/threonine- protein kinase Sgk3, SGK3 ELISA KIT

ELI-15570h 96 Tests
EUR 824

Mouse Serine/threonine- protein kinase Sgk3, Sgk3 ELISA KIT

ELI-39349m 96 Tests
EUR 865

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Polyclonal Antibody (Mouse)

4-PAE577Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGK3 (His141~Glu368)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serum/Glucocorticoid Regulated Kinase 3 (SGK3)

Mouse SGK3 shRNA Plasmid

20-abx980331
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SGK3 ELISA KIT|Human

EF002880 96 Tests
EUR 689

Human SGK3 shRNA Plasmid

20-abx958435
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-C8orf44-SGK3

PVT13771 2 ug
EUR 391

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Polyclonal Antibody (Mouse), APC

4-PAE577Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGK3 (His141~Glu368)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serum/Glucocorticoid Regulated Kinase 3 (SGK3). This antibody is labeled with APC.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Polyclonal Antibody (Mouse), Biotinylated

4-PAE577Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGK3 (His141~Glu368)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serum/Glucocorticoid Regulated Kinase 3 (SGK3). This antibody is labeled with Biotin.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Polyclonal Antibody (Mouse), Cy3

4-PAE577Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGK3 (His141~Glu368)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serum/Glucocorticoid Regulated Kinase 3 (SGK3). This antibody is labeled with Cy3.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Polyclonal Antibody (Mouse), FITC

4-PAE577Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGK3 (His141~Glu368)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serum/Glucocorticoid Regulated Kinase 3 (SGK3). This antibody is labeled with FITC.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Polyclonal Antibody (Mouse), HRP

4-PAE577Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGK3 (His141~Glu368)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serum/Glucocorticoid Regulated Kinase 3 (SGK3). This antibody is labeled with HRP.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Polyclonal Antibody (Mouse), PE

4-PAE577Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGK3 (His141~Glu368)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serum/Glucocorticoid Regulated Kinase 3 (SGK3). This antibody is labeled with PE.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Polyclonal Antibody (Mouse), APC-Cy7

4-PAE577Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SGK3 (His141~Glu368)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serum/Glucocorticoid Regulated Kinase 3 (SGK3). This antibody is labeled with APC-Cy7.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Antibody

20-abx115485
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Antibody

20-abx104089
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Antibody

abx033783-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Antibody

abx033783-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Antibody

abx033784-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Antibody

abx033784-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Antibody

20-abx005881
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Antibody

20-abx320363
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serum/Glucocorticoid Regulated Kinase 3 (SGK3) Antibody

abx237808-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Phospho-SGK3 (Thr320) Blocking Peptide

AF2402-BP 1mg
EUR 195

Phospho-SGK3 (Ser486) Blocking Peptide

AF7430-BP 1mg
EUR 195

SGK3 ORF Vector (Human) (pORF)

ORF009463 1.0 ug DNA
EUR 95

h SGK3 inducible lentiviral particles

LVP240 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, SGK3, is fully sequence verified and matched to NCBI accession ID: NM_013257

Sgk3 ORF Vector (Mouse) (pORF)

ORF057165 1.0 ug DNA
EUR 506

Sgk3 ORF Vector (Mouse) (pORF)

ORF057166 1.0 ug DNA
EUR 506

Sgk3 ORF Vector (Mouse) (pORF)

ORF057167 1.0 ug DNA
EUR 506

SGK3 sgRNA CRISPR Lentivector set (Human)

K2136901 3 x 1.0 ug
EUR 339

Sgk3 sgRNA CRISPR Lentivector set (Mouse)

K3632101 3 x 1.0 ug
EUR 339

SGK3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2136902 1.0 ug DNA
EUR 154

SGK3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2136903 1.0 ug DNA
EUR 154

SGK3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2136904 1.0 ug DNA
EUR 154

Sgk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3632102 1.0 ug DNA
EUR 154

Sgk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3632103 1.0 ug DNA
EUR 154

Sgk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3632104 1.0 ug DNA
EUR 154

SGK3 Rabbit Polyclonal Antibody