SUMO3 Rabbit Polyclonal Antibody

SUMO3 Rabbit Polyclonal Antibody

SUMO3 Polyclonal Antibody

ES10849-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SUMO3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SUMO3 Polyclonal Antibody

ABP60554-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SUMO3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SUMO3 from Human, Mouse, Rat. This SUMO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO3 protein

SUMO3 Polyclonal Antibody

ABP60554-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SUMO3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SUMO3 from Human, Mouse, Rat. This SUMO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO3 protein

SUMO3 Polyclonal Antibody

ABP60554-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SUMO3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SUMO3 from Human, Mouse, Rat. This SUMO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO3 protein

SUMO3 Rabbit pAb

A10896-100ul 100 ul
EUR 308

SUMO3 Rabbit pAb

A10896-200ul 200 ul
EUR 459

SUMO3 Rabbit pAb

A10896-20ul 20 ul Ask for price

SUMO3 Rabbit pAb

A10896-50ul 50 ul Ask for price

SUMO3 Rabbit pAb

A3099-100ul 100 ul
EUR 308

SUMO3 Rabbit pAb

A3099-200ul 200 ul
EUR 459

SUMO3 Rabbit pAb

A3099-20ul 20 ul
EUR 183

SUMO3 Rabbit pAb

A3099-50ul 50 ul
EUR 223

SUMO3 Rabbit pAb

A15724-100ul 100 ul
EUR 308

SUMO3 Rabbit pAb

A15724-200ul 200 ul
EUR 459

SUMO3 Rabbit pAb

A15724-20ul 20 ul
EUR 183

SUMO3 Rabbit pAb

A15724-50ul 50 ul
EUR 223

SUMO3 antibody

70R-3146 50 ug
EUR 467
Description: Rabbit polyclonal SUMO3 antibody

SUMO3 Antibody

ABD7185 100 ug
EUR 438

SUMO3 antibody

38578-100ul 100ul
EUR 252

SUMO3 Antibody

25118-100ul 100ul
EUR 390

SUMO3 Antibody

DF7185 200ul
EUR 304
Description: SUMO3 Antibody detects endogenous levels of total SUMO3.

SUMO3 Antibody

1-CSB-PA05509A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SUMO3. Recognizes SUMO3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Polyclonal SUMO3 antibody - middle region

APR01376G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO3 - middle region. This antibody is tested and proven to work in the following applications:

SUMO3 Conjugated Antibody

C38578 100ul
EUR 397

SUMO3 Antibody (HRP)

20-abx317284
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SUMO3 Antibody (FITC)

20-abx317285
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SUMO3 Antibody (Biotin)

20-abx317286
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-SUMO3 antibody

STJ25750 100 µl
EUR 277
Description: This gene encodes a member of the small ubiquitin-related modifier (SUMO) family of eukaryotic proteins. The encoded protein is covalently conjugated to other proteins via a post-translation modification known as sumoylation. Sumoylation may play a role in a wide variety of cellular processes, including nuclear transport, DNA replication and repair, mitosis, transcriptional regulation, and signal transduction. Alternatively spliced transcript variants encoding distinct proteins have been described.

Anti-SUMO3 antibody

STJ112792 100 µl
EUR 277
Description: This gene encodes a member of the small ubiquitin-related modifier (SUMO) family of eukaryotic proteins. The encoded protein is covalently conjugated to other proteins via a post-translation modification known as sumoylation. Sumoylation may play a role in a wide variety of cellular processes, including nuclear transport, DNA replication and repair, mitosis, transcriptional regulation, and signal transduction. Alternatively spliced transcript variants encoding distinct proteins have been described.

Anti-SUMO3 antibody

STJ118184 100 µl
EUR 277

Anti-SUMO3 antibody

STJ192007 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SUMO3

Sumo3/ Rat Sumo3 ELISA Kit

ELI-46213r 96 Tests
EUR 886

SUMO3 siRNA

20-abx905376
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SUMO3 Protein

E28004 100 µg
EUR 353.05
Description: kits suitable for this type of research

SUMO3 protein

30R-2787 100 ug
EUR 336
Description: Purified recombinant Human SUMO3 protein

SUMO3 siRNA

20-abx935668
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SUMO3 siRNA

20-abx935669
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SUMO2/SUMO3/SUMO4 Antibody

36877-100ul 100ul
EUR 252

SUMO3 Antibody, HRP conjugated

1-CSB-PA05509B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SUMO3. Recognizes SUMO3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SUMO3 Antibody, FITC conjugated

1-CSB-PA05509C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SUMO3. Recognizes SUMO3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SUMO3 Antibody, Biotin conjugated

1-CSB-PA05509D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SUMO3. Recognizes SUMO3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rabbit Anti-SUMO2, SUMO3 monoclonal antibody, clone KK198-15

CABT-L819 100 ul
EUR 777

SUMO3 cloning plasmid

CSB-CL022951HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 312
  • Sequence: atgtccgaggagaagcccaaggagggtgtgaagacagagaatgaccacatcaacctgaaggtggccgggcaggacggctccgtggtgcagttcaagatcaagaggcacacgccgctgagcaagctgatgaaggcctactgcgagaggcagggcttgtcaatgaggcagatcagatt
  • Show more
Description: A cloning plasmid for the SUMO3 gene.

SUMO3-biotin Protein

E28005 50 µg
EUR 338.55
Description: Ask the seller for details

SUMO3 Blocking Peptide

20-abx161475
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

SUMO3 Blocking Peptide

33R-6376 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SUMO3 antibody, catalog no. 70R-3146

SUMO3, human recombinant

4943-100
EUR 251

SUMO3, human recombinant

4943-1000
EUR 1518

SUMO3 Blocking Peptide

DF7185-BP 1mg
EUR 195

pWPXLd-SUMO3 Plasmid

PVTB00795-4a 2 ug
EUR 356

pENTR223-SUMO3 vector

PVT11832 2 ug
EUR 304

SUMO2/SUMO3/SUMO4 Conjugated Antibody

C36877 100ul
EUR 397

Monoclonal SUMO3 Antibody, Clone: 76AT630.91.31

AMM02328G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human SUMO3. The antibodies are raised in Mouse and are from clone 76AT630.91.31. This antibody is applicable in WB, E

Human SUMO3 shRNA Plasmid

20-abx954495
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SUMO3 protein (His tag)

80R-1512 100 ug
EUR 305
Description: Purified recombinant Human SUMO3 protein

Mouse SUMO3 shRNA Plasmid

20-abx972791
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SUMO3 shRNA Plasmid

20-abx990901
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SUMO3 Recombinant Protein (Human)

RP030646 100 ug Ask for price

SUMO3 Recombinant Protein (Rat)

RP231731 100 ug Ask for price

SUMO3 Recombinant Protein (Mouse)

RP176453 100 ug Ask for price

p3*Flag- SUMO3- A99V

PVT10173 2 ug
EUR 301

Rabbit Small ubiquitin related modifier 3(SUMO3) ELISA kit

E04S0424-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Small ubiquitin related modifier 3(SUMO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Small ubiquitin related modifier 3(SUMO3) ELISA kit

E04S0424-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Small ubiquitin related modifier 3(SUMO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Small ubiquitin related modifier 3(SUMO3) ELISA kit

E04S0424-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Small ubiquitin related modifier 3(SUMO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody

20-abx127059
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody

20-abx121765
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody

20-abx002228
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody

abx036010-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody

abx025175-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody

abx025175-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody

20-abx302381
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sumo3 ORF Vector (Mouse) (pORF)

ORF058819 1.0 ug DNA
EUR 506

SUMO3 ORF Vector (Human) (pORF)

ORF010216 1.0 ug DNA
EUR 95

Sumo3 ORF Vector (Rat) (pORF)

ORF077245 1.0 ug DNA
EUR 506

SUMO3 sgRNA CRISPR Lentivector set (Human)

K2314601 3 x 1.0 ug
EUR 339

Sumo3 sgRNA CRISPR Lentivector set (Mouse)

K3419001 3 x 1.0 ug
EUR 339

Sumo3 sgRNA CRISPR Lentivector set (Rat)

K6572201 3 x 1.0 ug
EUR 339

SUMO3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2314602 1.0 ug DNA
EUR 154

SUMO3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2314603 1.0 ug DNA
EUR 154

SUMO3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2314604 1.0 ug DNA
EUR 154

Sumo3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3419002 1.0 ug DNA
EUR 154

Sumo3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3419003 1.0 ug DNA
EUR 154

Sumo3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3419004 1.0 ug DNA
EUR 154

Sumo3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6572202 1.0 ug DNA
EUR 154

Sumo3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6572203 1.0 ug DNA
EUR 154

Sumo3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6572204 1.0 ug DNA
EUR 154

SUMO3 Protein Vector (Human) (pPB-C-His)

PV040861 500 ng
EUR 329

SUMO3 Protein Vector (Human) (pPB-N-His)

PV040862 500 ng
EUR 329

SUMO3 Protein Vector (Human) (pPM-C-HA)

PV040863 500 ng
EUR 329

SUMO3 Protein Vector (Human) (pPM-C-His)

PV040864 500 ng
EUR 329

pPLK/GFP+Puro-SUMO3 shRNA-1 Plasmid

PVTB00795-3a 2 ug
EUR 356

pPLK/GFP+Puro-SUMO3 shRNA-2 Plasmid

PVTB00795-3b 2 ug
EUR 356

pPLK/GFP+Puro-SUMO3 shRNA-3 Plasmid

PVTB00795-3c 2 ug
EUR 356

pPLK/GFP+Puro-SUMO3 shRNA-4 Plasmid

PVTB00795-3d 2 ug
EUR 356

Recombinant Human SUMO3 Protein, His, E.coli-1mg

QP13650-1mg 1mg
EUR 2757

Recombinant Human SUMO3 Protein, His, E.coli-20ug

QP13650-20ug 20ug
EUR 201

Recombinant Human SUMO3 Protein, His, E.coli-5ug

QP13650-5ug 5ug
EUR 155

SUMO3 Protein Vector (Rat) (pPB-C-His)

PV308978 500 ng
EUR 603

SUMO3 Protein Vector (Rat) (pPB-N-His)

PV308979 500 ng
EUR 603

SUMO3 Protein Vector (Rat) (pPM-C-HA)

PV308980 500 ng
EUR 603

SUMO3 Protein Vector (Rat) (pPM-C-His)

PV308981 500 ng
EUR 603

SUMO3 Protein Vector (Mouse) (pPB-C-His)

PV235274 500 ng
EUR 603

SUMO3 Protein Vector (Mouse) (pPB-N-His)

PV235275 500 ng
EUR 603

SUMO3 Protein Vector (Mouse) (pPM-C-HA)

PV235276 500 ng
EUR 603

SUMO3 Protein Vector (Mouse) (pPM-C-His)

PV235277 500 ng
EUR 603

Sumo3 3'UTR GFP Stable Cell Line

TU169947 1.0 ml Ask for price

SUMO3 Rabbit Polyclonal Antibody