SUMO3 Rabbit Polyclonal Antibody
SUMO3 Polyclonal Antibody |
ES10849-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against SUMO3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SUMO3 Polyclonal Antibody |
ABP60554-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human SUMO3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SUMO3 from Human, Mouse, Rat. This SUMO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO3 protein |
SUMO3 Polyclonal Antibody |
ABP60554-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SUMO3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SUMO3 from Human, Mouse, Rat. This SUMO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO3 protein |
SUMO3 Polyclonal Antibody |
ABP60554-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SUMO3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SUMO3 from Human, Mouse, Rat. This SUMO3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO3 protein |
SUMO3 Rabbit pAb |
A10896-100ul |
Abclonal |
100 ul |
EUR 308 |
SUMO3 Rabbit pAb |
A10896-200ul |
Abclonal |
200 ul |
EUR 459 |
SUMO3 Rabbit pAb |
A10896-20ul |
Abclonal |
20 ul |
Ask for price |
SUMO3 Rabbit pAb |
A10896-50ul |
Abclonal |
50 ul |
Ask for price |
SUMO3 Rabbit pAb |
A3099-100ul |
Abclonal |
100 ul |
EUR 308 |
SUMO3 Rabbit pAb |
A3099-200ul |
Abclonal |
200 ul |
EUR 459 |
SUMO3 Rabbit pAb |
A3099-20ul |
Abclonal |
20 ul |
EUR 183 |
SUMO3 Rabbit pAb |
A3099-50ul |
Abclonal |
50 ul |
EUR 223 |
SUMO3 Rabbit pAb |
A15724-100ul |
Abclonal |
100 ul |
EUR 308 |
SUMO3 Rabbit pAb |
A15724-200ul |
Abclonal |
200 ul |
EUR 459 |
SUMO3 Rabbit pAb |
A15724-20ul |
Abclonal |
20 ul |
EUR 183 |
SUMO3 Rabbit pAb |
A15724-50ul |
Abclonal |
50 ul |
EUR 223 |
SUMO3 antibody |
70R-3146 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SUMO3 antibody |
SUMO3 antibody |
38578-100ul |
SAB |
100ul |
EUR 252 |
SUMO3 Antibody |
25118-100ul |
SAB |
100ul |
EUR 390 |
SUMO3 Antibody |
DF7185 |
Affbiotech |
200ul |
EUR 304 |
Description: SUMO3 Antibody detects endogenous levels of total SUMO3. |
SUMO3 Antibody |
1-CSB-PA05509A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SUMO3. Recognizes SUMO3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Polyclonal SUMO3 antibody - middle region |
APR01376G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO3 - middle region. This antibody is tested and proven to work in the following applications: |
SUMO3 Conjugated Antibody |
C38578 |
SAB |
100ul |
EUR 397 |
SUMO3 Antibody (HRP) |
20-abx317284 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
SUMO3 Antibody (FITC) |
20-abx317285 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
SUMO3 Antibody (Biotin) |
20-abx317286 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-SUMO3 antibody |
STJ25750 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the small ubiquitin-related modifier (SUMO) family of eukaryotic proteins. The encoded protein is covalently conjugated to other proteins via a post-translation modification known as sumoylation. Sumoylation may play a role in a wide variety of cellular processes, including nuclear transport, DNA replication and repair, mitosis, transcriptional regulation, and signal transduction. Alternatively spliced transcript variants encoding distinct proteins have been described. |
Anti-SUMO3 antibody |
STJ112792 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the small ubiquitin-related modifier (SUMO) family of eukaryotic proteins. The encoded protein is covalently conjugated to other proteins via a post-translation modification known as sumoylation. Sumoylation may play a role in a wide variety of cellular processes, including nuclear transport, DNA replication and repair, mitosis, transcriptional regulation, and signal transduction. Alternatively spliced transcript variants encoding distinct proteins have been described. |
Anti-SUMO3 antibody |
STJ192007 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SUMO3 |
SUMO3 siRNA |
20-abx905376 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SUMO3 Protein |
E28004 |
EpiGentek |
100 µg |
EUR 353.05 |
Description: kits suitable for this type of research |
SUMO3 protein |
30R-2787 |
Fitzgerald |
100 ug |
EUR 336 |
Description: Purified recombinant Human SUMO3 protein |
SUMO3 siRNA |
20-abx935668 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SUMO3 siRNA |
20-abx935669 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SUMO2/SUMO3/SUMO4 Antibody |
36877-100ul |
SAB |
100ul |
EUR 252 |
SUMO3 Antibody, HRP conjugated |
1-CSB-PA05509B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SUMO3. Recognizes SUMO3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SUMO3 Antibody, FITC conjugated |
1-CSB-PA05509C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SUMO3. Recognizes SUMO3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SUMO3 Antibody, Biotin conjugated |
1-CSB-PA05509D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SUMO3. Recognizes SUMO3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Rabbit Anti-SUMO2, SUMO3 monoclonal antibody, clone KK198-15 |
CABT-L819 |
Creative Diagnostics |
100 ul |
EUR 777 |
SUMO3 cloning plasmid |
CSB-CL022951HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 312
- Sequence: atgtccgaggagaagcccaaggagggtgtgaagacagagaatgaccacatcaacctgaaggtggccgggcaggacggctccgtggtgcagttcaagatcaagaggcacacgccgctgagcaagctgatgaaggcctactgcgagaggcagggcttgtcaatgaggcagatcagatt
- Show more
|
Description: A cloning plasmid for the SUMO3 gene. |
SUMO3-biotin Protein |
E28005 |
EpiGentek |
50 µg |
EUR 338.55 |
Description: Ask the seller for details |
SUMO3 Blocking Peptide |
20-abx161475 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SUMO3 Blocking Peptide |
33R-6376 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SUMO3 antibody, catalog no. 70R-3146 |
SUMO3, human recombinant |
4943-100 |
Biovision |
|
EUR 251 |
SUMO3, human recombinant |
4943-1000 |
Biovision |
|
EUR 1518 |
SUMO3 Blocking Peptide |
DF7185-BP |
Affbiotech |
1mg |
EUR 195 |
SUMO2/SUMO3/SUMO4 Conjugated Antibody |
C36877 |
SAB |
100ul |
EUR 397 |
Monoclonal SUMO3 Antibody, Clone: 76AT630.91.31 |
AMM02328G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human SUMO3. The antibodies are raised in Mouse and are from clone 76AT630.91.31. This antibody is applicable in WB, E |
Human SUMO3 shRNA Plasmid |
20-abx954495 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SUMO3 protein (His tag) |
80R-1512 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human SUMO3 protein |
Mouse SUMO3 shRNA Plasmid |
20-abx972791 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat SUMO3 shRNA Plasmid |
20-abx990901 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SUMO3 Recombinant Protein (Human) |
RP030646 |
ABM |
100 ug |
Ask for price |
SUMO3 Recombinant Protein (Rat) |
RP231731 |
ABM |
100 ug |
Ask for price |
SUMO3 Recombinant Protein (Mouse) |
RP176453 |
ABM |
100 ug |
Ask for price |
Rabbit Small ubiquitin related modifier 3(SUMO3) ELISA kit |
E04S0424-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Small ubiquitin related modifier 3(SUMO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Small ubiquitin related modifier 3(SUMO3) ELISA kit |
E04S0424-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Small ubiquitin related modifier 3(SUMO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Small ubiquitin related modifier 3(SUMO3) ELISA kit |
E04S0424-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Small ubiquitin related modifier 3(SUMO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody |
20-abx127059 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody |
20-abx121765 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody |
20-abx002228 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody |
abx036010-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody |
abx025175-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody |
abx025175-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Small Ubiquitin-Related Modifier 3 (SUMO3) Antibody |
20-abx302381 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Sumo3 ORF Vector (Mouse) (pORF) |
ORF058819 |
ABM |
1.0 ug DNA |
EUR 506 |
SUMO3 ORF Vector (Human) (pORF) |
ORF010216 |
ABM |
1.0 ug DNA |
EUR 95 |
Sumo3 ORF Vector (Rat) (pORF) |
ORF077245 |
ABM |
1.0 ug DNA |
EUR 506 |
SUMO3 sgRNA CRISPR Lentivector set (Human) |
K2314601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sumo3 sgRNA CRISPR Lentivector set (Mouse) |
K3419001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sumo3 sgRNA CRISPR Lentivector set (Rat) |
K6572201 |
ABM |
3 x 1.0 ug |
EUR 339 |
SUMO3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2314602 |
ABM |
1.0 ug DNA |
EUR 154 |
SUMO3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2314603 |
ABM |
1.0 ug DNA |
EUR 154 |
SUMO3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2314604 |
ABM |
1.0 ug DNA |
EUR 154 |
Sumo3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3419002 |
ABM |
1.0 ug DNA |
EUR 154 |
Sumo3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3419003 |
ABM |
1.0 ug DNA |
EUR 154 |
Sumo3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3419004 |
ABM |
1.0 ug DNA |
EUR 154 |
Sumo3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6572202 |
ABM |
1.0 ug DNA |
EUR 154 |
Sumo3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6572203 |
ABM |
1.0 ug DNA |
EUR 154 |
Sumo3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6572204 |
ABM |
1.0 ug DNA |
EUR 154 |
SUMO3 Protein Vector (Human) (pPB-C-His) |
PV040861 |
ABM |
500 ng |
EUR 329 |
SUMO3 Protein Vector (Human) (pPB-N-His) |
PV040862 |
ABM |
500 ng |
EUR 329 |
SUMO3 Protein Vector (Human) (pPM-C-HA) |
PV040863 |
ABM |
500 ng |
EUR 329 |
SUMO3 Protein Vector (Human) (pPM-C-His) |
PV040864 |
ABM |
500 ng |
EUR 329 |
Recombinant Human SUMO3 Protein, His, E.coli-1mg |
QP13650-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human SUMO3 Protein, His, E.coli-20ug |
QP13650-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human SUMO3 Protein, His, E.coli-5ug |
QP13650-5ug |
EnQuireBio |
5ug |
EUR 155 |
SUMO3 Protein Vector (Rat) (pPB-C-His) |
PV308978 |
ABM |
500 ng |
EUR 603 |
SUMO3 Protein Vector (Rat) (pPB-N-His) |
PV308979 |
ABM |
500 ng |
EUR 603 |
SUMO3 Protein Vector (Rat) (pPM-C-HA) |
PV308980 |
ABM |
500 ng |
EUR 603 |
SUMO3 Protein Vector (Rat) (pPM-C-His) |
PV308981 |
ABM |
500 ng |
EUR 603 |
SUMO3 Protein Vector (Mouse) (pPB-C-His) |
PV235274 |
ABM |
500 ng |
EUR 603 |
SUMO3 Protein Vector (Mouse) (pPB-N-His) |
PV235275 |
ABM |
500 ng |
EUR 603 |
SUMO3 Protein Vector (Mouse) (pPM-C-HA) |
PV235276 |
ABM |
500 ng |
EUR 603 |
SUMO3 Protein Vector (Mouse) (pPM-C-His) |
PV235277 |
ABM |
500 ng |
EUR 603 |
Sumo3 3'UTR GFP Stable Cell Line |
TU169947 |
ABM |
1.0 ml |
Ask for price |
SUMO3 Rabbit Polyclonal Antibody