TMED1 Rabbit Polyclonal Antibody
TMED1 Polyclonal Antibody |
ES10878-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TMED1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TMED1 Polyclonal Antibody |
ES10878-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TMED1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TMED1 Rabbit pAb |
A9963-100ul |
Abclonal |
100 ul |
EUR 308 |
TMED1 Rabbit pAb |
A9963-200ul |
Abclonal |
200 ul |
EUR 459 |
TMED1 Rabbit pAb |
A9963-20ul |
Abclonal |
20 ul |
EUR 183 |
TMED1 Rabbit pAb |
A9963-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal TMED1 Antibody (Center) |
APR04242G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMED1 (Center). This antibody is tested and proven to work in the following applications: |
TMED1 antibody |
10R-6071 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal TMED1 antibody |
TMED1 antibody |
10R-6072 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal TMED1 antibody |
TMED1 Antibody |
40154-100ul |
SAB |
100ul |
EUR 252 |
TMED1 Antibody |
1-CSB-PA053790 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TMED1. Recognizes TMED1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
TMED1 Antibody |
1-CSB-PA619766ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against TMED1. Recognizes TMED1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
TMED1 Antibody |
1-CSB-PA250986 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TMED1. Recognizes TMED1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
TMED1 antibody |
70R-7395 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TMED1 antibody raised against the middle region of TMED1 |
Tmed1 antibody |
70R-8661 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Tmed1 antibody |
Rabbit TMED1 ELISA Kit |
ERTT0241 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal Tmed1 antibody - N-terminal region |
APR00988G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Tmed1 - N-terminal region. This antibody is tested and proven to work in the following applications: |
TMED1 Conjugated Antibody |
C40154 |
SAB |
100ul |
EUR 397 |
Anti-TMED1 antibody |
STJ112004 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene belongs to the TMED (transmembrane emp24 domain-containing) protein family, which is involved in the vesicular trafficking of proteins. The protein encoded by this gene was identified by its interaction with interleukin 1 receptor-like 1 (IL1RL1) and may play a role in innate immunity. This protein lacks any similarity to other interleukin 1 ligands. Alternative splicing results in multiple transcript variants of this gene. |
Anti-TMED1 antibody |
STJ192036 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TMED1 |
TMED1 siRNA |
20-abx905608 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMED1 siRNA |
20-abx936991 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMED1 siRNA |
20-abx936992 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TMED1 |
YF-PA17365 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to TMED1 |
Tmed1 Blocking Peptide |
33R-2259 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Tmed1 antibody, catalog no. 70R-8661 |
TMED1 Blocking Peptide |
33R-3095 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMED1 antibody, catalog no. 70R-7395 |
TMED1 cloning plasmid |
CSB-CL619766HU-10ug |
Cusabio |
10ug |
EUR 301 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 684
- Sequence: atgatggcggccggcgcggccctagccctggccttgtggctactaatgccaccagtggaggtgggaggggcggggcccccgccaatccaggacggtgagttcacgttcctgttgccggcggggaggaagcagtgtttctaccagtccgcgccggccaacgcaagcctcgagaccga
- Show more
|
Description: A cloning plasmid for the TMED1 gene. |
Human TMED1 ELISA Kit |
EHT0241 |
Abclonal |
96Tests |
EUR 521 |
Bovine TMED1 ELISA Kit |
EBT0241 |
Abclonal |
96Tests |
EUR 521 |
Anserini TMED1 ELISA Kit |
EAT0241 |
Abclonal |
96Tests |
EUR 521 |
Chicken TMED1 ELISA Kit |
ECKT0241 |
Abclonal |
96Tests |
EUR 521 |
Canine TMED1 ELISA Kit |
ECT0241 |
Abclonal |
96Tests |
EUR 521 |
Goat TMED1 ELISA Kit |
EGTT0241 |
Abclonal |
96Tests |
EUR 521 |
Rat TMED1 shRNA Plasmid |
20-abx989882 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TMED1 shRNA Plasmid |
20-abx957527 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse TMED1 shRNA Plasmid |
20-abx971388 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Sheep TMED1 ELISA Kit |
EST0241 |
Abclonal |
96Tests |
EUR 521 |
Porcine TMED1 ELISA Kit |
EPT0241 |
Abclonal |
96Tests |
EUR 521 |
Rat TMED1 ELISA Kit |
ERT0241 |
Abclonal |
96Tests |
EUR 521 |
Monkey TMED1 ELISA Kit |
EMKT0241 |
Abclonal |
96Tests |
EUR 521 |
Mouse TMED1 ELISA Kit |
EMT0241 |
Abclonal |
96Tests |
EUR 521 |
TMED1 Recombinant Protein (Rat) |
RP233381 |
ABM |
100 ug |
Ask for price |
TMED1 Recombinant Protein (Human) |
RP031804 |
ABM |
100 ug |
Ask for price |
TMED1 Recombinant Protein (Mouse) |
RP179141 |
ABM |
100 ug |
Ask for price |
Guinea Pig TMED1 ELISA Kit |
EGT0241 |
Abclonal |
96Tests |
EUR 521 |
Tmed1 ORF Vector (Rat) (pORF) |
ORF077795 |
ABM |
1.0 ug DNA |
EUR 506 |
TMED1 ORF Vector (Human) (pORF) |
ORF010602 |
ABM |
1.0 ug DNA |
EUR 95 |
Tmed1 ORF Vector (Mouse) (pORF) |
ORF059715 |
ABM |
1.0 ug DNA |
EUR 506 |
TMED1 ELISA Kit (Mouse) (OKEI00574) |
OKEI00574 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Potential role in vesicular protein trafficking, mainly in the early secretory pathway. May act as a cargo receptor at the lumenal side for incorporation of secretory cargo molecules into transport vesicles and may be involved in vesicle coat formation at the cytoplasmic side.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
TMED1 ELISA Kit (Rat) (OKEI00869) |
OKEI00869 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Potential role in vesicular protein trafficking, mainly in the early secretory pathway. May act as a cargo receptor at the lumenal side for incorporation of secretory cargo molecules into transport vesicles and may be involved in vesicle coat formation at the cytoplasmic side.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody |
20-abx214074 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody |
20-abx135883 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody |
abx145018-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody |
abx029738-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody |
abx029738-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody |
20-abx241934 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody |
20-abx321170 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tmed1 sgRNA CRISPR Lentivector set (Rat) |
K7301401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tmed1 sgRNA CRISPR Lentivector set (Mouse) |
K4575901 |
ABM |
3 x 1.0 ug |
EUR 339 |
TMED1 sgRNA CRISPR Lentivector set (Human) |
K2385001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tmed1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7301402 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmed1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7301403 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmed1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7301404 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmed1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4575902 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmed1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4575903 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmed1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4575904 |
ABM |
1.0 ug DNA |
EUR 154 |
TMED1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2385002 |
ABM |
1.0 ug DNA |
EUR 154 |
TMED1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2385003 |
ABM |
1.0 ug DNA |
EUR 154 |
TMED1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2385004 |
ABM |
1.0 ug DNA |
EUR 154 |
TMED1 Protein Vector (Rat) (pPB-C-His) |
PV311178 |
ABM |
500 ng |
EUR 603 |
TMED1 Protein Vector (Rat) (pPB-N-His) |
PV311179 |
ABM |
500 ng |
EUR 603 |
TMED1 Protein Vector (Rat) (pPM-C-HA) |
PV311180 |
ABM |
500 ng |
EUR 603 |
TMED1 Protein Vector (Rat) (pPM-C-His) |
PV311181 |
ABM |
500 ng |
EUR 603 |
TMED1 Protein Vector (Mouse) (pPB-C-His) |
PV238858 |
ABM |
500 ng |
EUR 603 |
TMED1 Protein Vector (Mouse) (pPB-N-His) |
PV238859 |
ABM |
500 ng |
EUR 603 |
TMED1 Protein Vector (Mouse) (pPM-C-HA) |
PV238860 |
ABM |
500 ng |
EUR 603 |
TMED1 Protein Vector (Mouse) (pPM-C-His) |
PV238861 |
ABM |
500 ng |
EUR 603 |
TMED1 Protein Vector (Human) (pPB-C-His) |
PV042405 |
ABM |
500 ng |
EUR 329 |
TMED1 Protein Vector (Human) (pPB-N-His) |
PV042406 |
ABM |
500 ng |
EUR 329 |
TMED1 Protein Vector (Human) (pPM-C-HA) |
PV042407 |
ABM |
500 ng |
EUR 329 |
TMED1 Protein Vector (Human) (pPM-C-His) |
PV042408 |
ABM |
500 ng |
EUR 329 |
Tmed1 3'UTR Luciferase Stable Cell Line |
TU120596 |
ABM |
1.0 ml |
Ask for price |
Tmed1 3'UTR GFP Stable Cell Line |
TU170596 |
ABM |
1.0 ml |
Ask for price |
Tmed1 3'UTR Luciferase Stable Cell Line |
TU221983 |
ABM |
1.0 ml |
Ask for price |
TMED1 3'UTR GFP Stable Cell Line |
TU075695 |
ABM |
1.0 ml |
EUR 1394 |
Tmed1 3'UTR GFP Stable Cell Line |
TU271983 |
ABM |
1.0 ml |
Ask for price |
TMED1 3'UTR Luciferase Stable Cell Line |
TU025695 |
ABM |
1.0 ml |
EUR 1394 |
TMED1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV692557 |
ABM |
1.0 ug DNA |
EUR 514 |
TMED1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV692561 |
ABM |
1.0 ug DNA |
EUR 514 |
TMED1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV692562 |
ABM |
1.0 ug DNA |
EUR 514 |
TMED1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV793099 |
ABM |
1.0 ug DNA |
EUR 316 |
TMED1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV793100 |
ABM |
1.0 ug DNA |
EUR 316 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
TMED1 Rabbit Polyclonal Antibody