TMED1 Rabbit Polyclonal Antibody

TMED1 Rabbit Polyclonal Antibody

TMED1 Polyclonal Antibody

ABP60710-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TMED1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TMED1 from Human, Mouse, Rat. This TMED1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TMED1 protein

TMED1 Polyclonal Antibody

ABP60710-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TMED1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TMED1 from Human, Mouse, Rat. This TMED1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TMED1 protein

TMED1 Rabbit pAb

A9963-100ul 100 ul
EUR 308

TMED1 Rabbit pAb

A9963-200ul 200 ul
EUR 459

TMED1 Rabbit pAb

A9963-20ul 20 ul
EUR 183

TMED1 Rabbit pAb

A9963-50ul 50 ul
EUR 223

Polyclonal TMED1 Antibody (Center)

APR04242G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMED1 (Center). This antibody is tested and proven to work in the following applications:

TMED1 antibody

70R-7395 50 ug
EUR 467
Description: Rabbit polyclonal TMED1 antibody raised against the middle region of TMED1

Tmed1 antibody

70R-8661 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Tmed1 antibody

TMED1 Antibody

40154-100ul 100ul
EUR 252

TMED1 antibody

10R-6071 100 ul
EUR 691
Description: Mouse monoclonal TMED1 antibody

TMED1 antibody

10R-6072 100 ul
EUR 726
Description: Mouse monoclonal TMED1 antibody

TMED1 Antibody

1-CSB-PA619766ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TMED1. Recognizes TMED1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TMED1 Antibody

1-CSB-PA250986
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TMED1. Recognizes TMED1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

TMED1 Antibody

1-CSB-PA053790
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TMED1. Recognizes TMED1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

Rabbit TMED1 ELISA Kit

ERTT0241 96Tests
EUR 521

Polyclonal Tmed1 antibody - N-terminal region

APR00988G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Tmed1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Tmed1/ Rat Tmed1 ELISA Kit

ELI-17120r 96 Tests
EUR 886

TMED1 Conjugated Antibody

C40154 100ul
EUR 397

Anti-TMED1 antibody

STJ112004 100 µl
EUR 277
Description: This gene belongs to the TMED (transmembrane emp24 domain-containing) protein family, which is involved in the vesicular trafficking of proteins. The protein encoded by this gene was identified by its interaction with interleukin 1 receptor-like 1 (IL1RL1) and may play a role in innate immunity. This protein lacks any similarity to other interleukin 1 ligands. Alternative splicing results in multiple transcript variants of this gene.

Anti-TMED1 antibody

STJ192036 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TMED1

TMED1 siRNA

20-abx905608
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMED1 siRNA

20-abx936991
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMED1 siRNA

20-abx936992
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-TMED1

PVT18756 2 ug
EUR 231

anti-TMED1

YF-PA17365 50 ug
EUR 363
Description: Mouse polyclonal to TMED1

Tmed1 Blocking Peptide

33R-2259 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Tmed1 antibody, catalog no. 70R-8661

TMED1 Blocking Peptide

33R-3095 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMED1 antibody, catalog no. 70R-7395

TMED1 cloning plasmid

CSB-CL619766HU-10ug 10ug
EUR 301
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 684
  • Sequence: atgatggcggccggcgcggccctagccctggccttgtggctactaatgccaccagtggaggtgggaggggcggggcccccgccaatccaggacggtgagttcacgttcctgttgccggcggggaggaagcagtgtttctaccagtccgcgccggccaacgcaagcctcgagaccga
  • Show more
Description: A cloning plasmid for the TMED1 gene.

Rat TMED1 shRNA Plasmid

20-abx989882
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TMED1 ELISA Kit

EHT0241 96Tests
EUR 521

Goat TMED1 ELISA Kit

EGTT0241 96Tests
EUR 521

Bovine TMED1 ELISA Kit

EBT0241 96Tests
EUR 521

Chicken TMED1 ELISA Kit

ECKT0241 96Tests
EUR 521

Anserini TMED1 ELISA Kit

EAT0241 96Tests
EUR 521

Canine TMED1 ELISA Kit

ECT0241 96Tests
EUR 521

Human TMED1 ELISA KIT

ELI-16303h 96 Tests
EUR 824

Porcine TMED1 ELISA Kit

EPT0241 96Tests
EUR 521

Rat TMED1 ELISA Kit

ERT0241 96Tests
EUR 521

Sheep TMED1 ELISA Kit

EST0241 96Tests
EUR 521

Mouse Tmed1 ELISA KIT

ELI-39891m 96 Tests
EUR 865

Bovine TMED1 ELISA KIT

ELI-40128b 96 Tests
EUR 928

Monkey TMED1 ELISA Kit

EMKT0241 96Tests
EUR 521

Mouse TMED1 ELISA Kit

EMT0241 96Tests
EUR 521

Human TMED1 shRNA Plasmid

20-abx957527
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TMED1 shRNA Plasmid

20-abx971388
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TMED1 Recombinant Protein (Human)

RP031804 100 ug Ask for price

TMED1 Recombinant Protein (Rat)

RP233381 100 ug Ask for price

TMED1 Recombinant Protein (Mouse)

RP179141 100 ug Ask for price

Guinea Pig TMED1 ELISA Kit

EGT0241 96Tests
EUR 521

Tmed1 ORF Vector (Mouse) (pORF)

ORF059715 1.0 ug DNA
EUR 506

TMED1 ORF Vector (Human) (pORF)

ORF010602 1.0 ug DNA
EUR 95

Tmed1 ORF Vector (Rat) (pORF)

ORF077795 1.0 ug DNA
EUR 506

Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody

abx145018-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody

20-abx135883
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody

abx029738-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody

abx029738-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody

20-abx321170
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody

20-abx214074
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transmembrane Emp24 Domain Containing Protein 1 (TMED1) Antibody

20-abx241934
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

TMED1 sgRNA CRISPR Lentivector set (Human)

K2385001 3 x 1.0 ug
EUR 339

Tmed1 sgRNA CRISPR Lentivector set (Mouse)

K4575901 3 x 1.0 ug
EUR 339

Tmed1 sgRNA CRISPR Lentivector set (Rat)

K7301401 3 x 1.0 ug
EUR 339

TMED1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2385002 1.0 ug DNA
EUR 154

TMED1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2385003 1.0 ug DNA
EUR 154

TMED1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2385004 1.0 ug DNA
EUR 154

Tmed1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4575902 1.0 ug DNA
EUR 154

Tmed1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4575903 1.0 ug DNA
EUR 154

Tmed1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4575904 1.0 ug DNA
EUR 154

Tmed1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7301402 1.0 ug DNA
EUR 154

Tmed1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7301403 1.0 ug DNA
EUR 154

Tmed1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7301404 1.0 ug DNA
EUR 154

TMED1 Protein Vector (Human) (pPB-C-His)

PV042405 500 ng
EUR 329

TMED1 Protein Vector (Human) (pPB-N-His)

PV042406 500 ng
EUR 329

TMED1 Protein Vector (Human) (pPM-C-HA)

PV042407 500 ng
EUR 329

TMED1 Protein Vector (Human) (pPM-C-His)

PV042408 500 ng
EUR 329

TMED1 Protein Vector (Rat) (pPB-C-His)

PV311178 500 ng
EUR 603

TMED1 Protein Vector (Rat) (pPB-N-His)

PV311179 500 ng
EUR 603

TMED1 Protein Vector (Rat) (pPM-C-HA)

PV311180 500 ng
EUR 603

TMED1 Protein Vector (Rat) (pPM-C-His)

PV311181 500 ng
EUR 603

TMED1 Protein Vector (Mouse) (pPB-C-His)

PV238858 500 ng
EUR 603

TMED1 Protein Vector (Mouse) (pPB-N-His)

PV238859 500 ng
EUR 603

TMED1 Protein Vector (Mouse) (pPM-C-HA)

PV238860 500 ng
EUR 603

TMED1 Protein Vector (Mouse) (pPM-C-His)

PV238861 500 ng
EUR 603

Tmed1 3'UTR GFP Stable Cell Line

TU170596 1.0 ml Ask for price

TMED1 3'UTR GFP Stable Cell Line

TU075695 1.0 ml
EUR 1394

Tmed1 3'UTR Luciferase Stable Cell Line

TU120596 1.0 ml Ask for price

TMED1 3'UTR Luciferase Stable Cell Line

TU025695 1.0 ml
EUR 1394

Tmed1 3'UTR Luciferase Stable Cell Line

TU221983 1.0 ml Ask for price

Tmed1 3'UTR GFP Stable Cell Line

TU271983 1.0 ml Ask for price

TMED1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV692557 1.0 ug DNA
EUR 514

TMED1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV692561 1.0 ug DNA
EUR 514

TMED1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV692562 1.0 ug DNA
EUR 514

TMED1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV793099 1.0 ug DNA
EUR 316

TMED1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV793100 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TMED1 Rabbit Polyclonal Antibody