TRIB2 Rabbit Polyclonal Antibody

TRIB2 Rabbit Polyclonal Antibody

TRIB2 Polyclonal Antibody

ES10839-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRIB2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TRIB2 Rabbit pAb

A11661-100ul 100 ul
EUR 308

TRIB2 Rabbit pAb

A11661-200ul 200 ul
EUR 459

TRIB2 Rabbit pAb

A11661-20ul 20 ul
EUR 183

TRIB2 Rabbit pAb

A11661-50ul 50 ul
EUR 223

TRIB2 antibody

70R-2069 50 ug
EUR 467
Description: Rabbit polyclonal TRIB2 antibody

TRIB2 antibody

70R-20972 50 ul
EUR 435
Description: Rabbit polyclonal TRIB2 antibody

TRIB2 antibody

10R-6127 100 ul
EUR 726
Description: Mouse monoclonal TRIB2 antibody

TRIB2 Antibody

43343-100ul 100ul
EUR 252

TRIB2 Antibody

1-CSB-PA838778LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

TRIB2 Antibody

DF2692 200ul
EUR 304
Description: TRIB2 antibody detects endogenous levels of total TRIB2.

TRIB2 Antibody

1-CSB-PA255282
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TRIB2 Antibody

1-CSB-PA172809
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100

TRIB2 Antibody

1-CSB-PA024445GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TRIB2 Antibody

ABD2692 100 ug
EUR 438

TRIB2 Conjugated Antibody

C43343 100ul
EUR 397

anti- TRIB2 antibody

FNab08965 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: tribbles homolog 2(Drosophila)
  • Uniprot ID: Q92519
  • Gene ID: 28951
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against TRIB2

Anti-TRIB2 antibody

PAab08965 100 ug
EUR 386

Anti-TRIB2 Antibody

PB9900 100ug/vial
EUR 334

Anti-TRIB2 antibody

STJ113262 100 µl
EUR 277
Description: This gene encodes one of three members of the Tribbles family. The Tribbles members share a Trb domain, which is homologous to protein serine-threonine kinases, but lacks the active site lysine and probably lacks a catalytic function. The Tribbles proteins interact and modulate the activity of signal transduction pathways in a number of physiological and pathological processes. This Tribbles member induces apoptosis of cells mainly of the hematopoietic origin. It has been identified as a protein up-regulated by inflammatory stimuli in myeloid (THP-1) cells, and also as an oncogene that inactivates the transcription factor C/EBPalpha (CCAAT/enhancer-binding protein alpha) and causes acute myelogenous leukemia. Alternatively spliced transcript variants have been found for this gene.

Anti-TRIB2 antibody

STJ191997 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRIB2

TRIB2 siRNA

20-abx938002
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRIB2 siRNA

20-abx938003
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TRIB2

YF-PA18507 50 ug
EUR 363
Description: Mouse polyclonal to TRIB2

anti-TRIB2

YF-PA18508 100 ug
EUR 403
Description: Rabbit polyclonal to TRIB2

anti-TRIB2

YF-PA26069 50 ul
EUR 334
Description: Mouse polyclonal to TRIB2

TRIB2 Antibody, HRP conjugated

1-CSB-PA838778LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRIB2 Antibody, FITC conjugated

1-CSB-PA838778LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TRIB2 Antibody, Biotin conjugated

1-CSB-PA838778LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TRIB2 Blocking Peptide

33R-10196 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIB2 antibody, catalog no. 70R-2069

TRIB2 Blocking Peptide

DF2692-BP 1mg
EUR 195

TRIB2 cloning plasmid

CSB-CL838778HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1032
  • Sequence: atgaacatacacaggtctacccccatcacaatagcgagatatgggagatcgcggaacaaaacccaggatttcgaagagttgtcgtctataaggtccgcggagcccagccagagtttcagcccgaacctcggctccccgagcccgcccgagactccgaacttgtcgcattgcgttt
  • Show more
Description: A cloning plasmid for the TRIB2 gene.

Anti-TRIB2 (1B1)

YF-MA11464 100 ug
EUR 363
Description: Mouse monoclonal to TRIB2

Anti-TRIB2 (1D11)

YF-MA18225 100 ug
EUR 363
Description: Mouse monoclonal to TRIB2

Tribbles Homolog 2 (TRIB2) Antibody

20-abx212421
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 2 (TRIB2) Antibody

20-abx212485
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 2 (TRIB2) Antibody

20-abx126737
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 2 (TRIB2) Antibody

abx238965-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tribbles Homolog 2 (TRIB2) Antibody

20-abx333916
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TRIB2 ELISA KIT|Human

EF003812 96 Tests
EUR 689

Canine TRIB2 ELISA KIT

ELI-51640d 96 Tests
EUR 928

Human TRIB2 shRNA Plasmid

20-abx959121
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TRIB2 shRNA Plasmid

20-abx981127
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TRIB2 Recombinant Protein (Rat)

RP234626 100 ug Ask for price

TRIB2 Recombinant Protein (Human)

RP032857 100 ug Ask for price

TRIB2 Recombinant Protein (Mouse)

RP181028 100 ug Ask for price

Tribbles Homolog 2 (TRIB2) Antibody (HRP)

20-abx338074
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tribbles Homolog 2 (TRIB2) Antibody (FITC)

20-abx338075
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tribbles Homolog 2 (TRIB2) Antibody (Biotin)

20-abx338076
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal TRIB2 Antibody (monoclonal) (M04), Clone: 1B1

AMM04243G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TRIB2 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 1B1. This antibody is applicable in WB and IHC, E

Trib2 ORF Vector (Rat) (pORF)

ORF078210 1.0 ug DNA
EUR 506

h TRIB2 inducible lentiviral particles

LVP042 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, TRIB2, is fully sequence verified and matched to NCBI accession ID: NM_021643

TRIB2 ORF Vector (Human) (pORF)

ORF010953 1.0 ug DNA
EUR 95

Trib2 ORF Vector (Mouse) (pORF)

ORF060344 1.0 ug DNA
EUR 506

Trib2 sgRNA CRISPR Lentivector set (Rat)

K6050001 3 x 1.0 ug
EUR 339

Trib2 sgRNA CRISPR Lentivector set (Mouse)

K4676101 3 x 1.0 ug
EUR 339

TRIB2 sgRNA CRISPR Lentivector set (Human)

K2462701 3 x 1.0 ug
EUR 339

Mouse Tribbles homolog 2, Trib2 ELISA KIT

ELI-17090m 96 Tests
EUR 865

Bovine Tribbles homolog 2, TRIB2 ELISA KIT

ELI-23157b 96 Tests
EUR 928

Human Tribbles homolog 2, TRIB2 ELISA KIT

ELI-51152h 96 Tests
EUR 824

Human Tribbles Homolog 2 (TRIB2) ELISA Kit

abx383918-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Trib2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6050002 1.0 ug DNA
EUR 154

Trib2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6050003 1.0 ug DNA
EUR 154

Trib2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6050004 1.0 ug DNA
EUR 154

Trib2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4676102 1.0 ug DNA
EUR 154

Trib2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4676103 1.0 ug DNA
EUR 154

Trib2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4676104 1.0 ug DNA
EUR 154

TRIB2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2462702 1.0 ug DNA
EUR 154

TRIB2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2462703 1.0 ug DNA
EUR 154

TRIB2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2462704 1.0 ug DNA
EUR 154

TRIB2 Protein Vector (Rat) (pPB-C-His)

PV312838 500 ng
EUR 603

TRIB2 Protein Vector (Rat) (pPB-N-His)

PV312839 500 ng
EUR 603

TRIB2 Protein Vector (Rat) (pPM-C-HA)

PV312840 500 ng
EUR 603

TRIB2 Protein Vector (Rat) (pPM-C-His)

PV312841 500 ng
EUR 603

TRIB2 Protein Vector (Mouse) (pPB-C-His)

PV241374 500 ng
EUR 603

TRIB2 Protein Vector (Mouse) (pPB-N-His)

PV241375 500 ng
EUR 603

TRIB2 Protein Vector (Mouse) (pPM-C-HA)

PV241376 500 ng
EUR 603

TRIB2 Protein Vector (Mouse) (pPM-C-His)

PV241377 500 ng
EUR 603

TRIB2 Protein Vector (Human) (pPB-C-His)

PV043809 500 ng
EUR 329

TRIB2 Protein Vector (Human) (pPB-N-His)

PV043810 500 ng
EUR 329

TRIB2 Protein Vector (Human) (pPM-C-HA)

PV043811 500 ng
EUR 329

TRIB2 Protein Vector (Human) (pPM-C-His)

PV043812 500 ng
EUR 329

Trib2 3'UTR Luciferase Stable Cell Line

TU121069 1.0 ml Ask for price

Trib2 3'UTR GFP Stable Cell Line

TU171069 1.0 ml Ask for price

Trib2 3'UTR Luciferase Stable Cell Line

TU222418 1.0 ml Ask for price

TRIB2 3'UTR GFP Stable Cell Line

TU076510 1.0 ml
EUR 1521

TRIB2 3'UTR Luciferase Stable Cell Line

TU026510 1.0 ml
EUR 1521

Trib2 3'UTR GFP Stable Cell Line

TU272418 1.0 ml Ask for price

TRIB2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV700123 1.0 ug DNA
EUR 514

TRIB2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV700127 1.0 ug DNA
EUR 514

TRIB2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV700128 1.0 ug DNA
EUR 514

TRIB2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV793141 1.0 ug DNA
EUR 316

TRIB2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV793142 1.0 ug DNA
EUR 316

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

TRIB2 Rabbit Polyclonal Antibody