TRIB2 Rabbit Polyclonal Antibody
TRIB2 Polyclonal Antibody |
ES10839-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TRIB2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TRIB2 Rabbit pAb |
A11661-100ul |
Abclonal |
100 ul |
EUR 308 |
TRIB2 Rabbit pAb |
A11661-200ul |
Abclonal |
200 ul |
EUR 459 |
TRIB2 Rabbit pAb |
A11661-20ul |
Abclonal |
20 ul |
EUR 183 |
TRIB2 Rabbit pAb |
A11661-50ul |
Abclonal |
50 ul |
EUR 223 |
TRIB2 antibody |
70R-2069 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TRIB2 antibody |
TRIB2 antibody |
70R-20972 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TRIB2 antibody |
TRIB2 antibody |
10R-6127 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal TRIB2 antibody |
TRIB2 Antibody |
43343-100ul |
SAB |
100ul |
EUR 252 |
TRIB2 Antibody |
1-CSB-PA838778LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
TRIB2 Antibody |
DF2692 |
Affbiotech |
200ul |
EUR 304 |
Description: TRIB2 antibody detects endogenous levels of total TRIB2. |
TRIB2 Antibody |
1-CSB-PA255282 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150 |
TRIB2 Antibody |
1-CSB-PA172809 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100 |
TRIB2 Antibody |
1-CSB-PA024445GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
TRIB2 Conjugated Antibody |
C43343 |
SAB |
100ul |
EUR 397 |
anti- TRIB2 antibody |
FNab08965 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- IHC: 1:20-1:200
- Immunogen: tribbles homolog 2(Drosophila)
- Uniprot ID: Q92519
- Gene ID: 28951
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against TRIB2 |
Anti-TRIB2 Antibody |
PB9900 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-TRIB2 antibody |
STJ113262 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes one of three members of the Tribbles family. The Tribbles members share a Trb domain, which is homologous to protein serine-threonine kinases, but lacks the active site lysine and probably lacks a catalytic function. The Tribbles proteins interact and modulate the activity of signal transduction pathways in a number of physiological and pathological processes. This Tribbles member induces apoptosis of cells mainly of the hematopoietic origin. It has been identified as a protein up-regulated by inflammatory stimuli in myeloid (THP-1) cells, and also as an oncogene that inactivates the transcription factor C/EBPalpha (CCAAT/enhancer-binding protein alpha) and causes acute myelogenous leukemia. Alternatively spliced transcript variants have been found for this gene. |
Anti-TRIB2 antibody |
STJ191997 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TRIB2 |
TRIB2 siRNA |
20-abx938002 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRIB2 siRNA |
20-abx938003 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TRIB2 |
YF-PA18507 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to TRIB2 |
anti-TRIB2 |
YF-PA18508 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to TRIB2 |
anti-TRIB2 |
YF-PA26069 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to TRIB2 |
TRIB2 Antibody, HRP conjugated |
1-CSB-PA838778LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TRIB2 Antibody, FITC conjugated |
1-CSB-PA838778LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TRIB2 Antibody, Biotin conjugated |
1-CSB-PA838778LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRIB2. Recognizes TRIB2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
TRIB2 Blocking Peptide |
33R-10196 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIB2 antibody, catalog no. 70R-2069 |
TRIB2 Blocking Peptide |
DF2692-BP |
Affbiotech |
1mg |
EUR 195 |
TRIB2 cloning plasmid |
CSB-CL838778HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1032
- Sequence: atgaacatacacaggtctacccccatcacaatagcgagatatgggagatcgcggaacaaaacccaggatttcgaagagttgtcgtctataaggtccgcggagcccagccagagtttcagcccgaacctcggctccccgagcccgcccgagactccgaacttgtcgcattgcgttt
- Show more
|
Description: A cloning plasmid for the TRIB2 gene. |
Anti-TRIB2 (1B1) |
YF-MA11464 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRIB2 |
Anti-TRIB2 (1D11) |
YF-MA18225 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRIB2 |
Tribbles Homolog 2 (TRIB2) Antibody |
20-abx212421 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 2 (TRIB2) Antibody |
20-abx212485 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 2 (TRIB2) Antibody |
20-abx126737 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 2 (TRIB2) Antibody |
abx238965-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Tribbles Homolog 2 (TRIB2) Antibody |
20-abx333916 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human TRIB2 shRNA Plasmid |
20-abx959121 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse TRIB2 shRNA Plasmid |
20-abx981127 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TRIB2 Recombinant Protein (Rat) |
RP234626 |
ABM |
100 ug |
Ask for price |
TRIB2 Recombinant Protein (Human) |
RP032857 |
ABM |
100 ug |
Ask for price |
TRIB2 Recombinant Protein (Mouse) |
RP181028 |
ABM |
100 ug |
Ask for price |
Tribbles Homolog 2 (TRIB2) Antibody (HRP) |
20-abx338074 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 2 (TRIB2) Antibody (FITC) |
20-abx338075 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 2 (TRIB2) Antibody (Biotin) |
20-abx338076 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Monoclonal TRIB2 Antibody (monoclonal) (M04), Clone: 1B1 |
AMM04243G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human TRIB2 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 1B1. This antibody is applicable in WB and IHC, E |
Trib2 ORF Vector (Rat) (pORF) |
ORF078210 |
ABM |
1.0 ug DNA |
EUR 506 |
h TRIB2 inducible lentiviral particles |
LVP042 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, TRIB2, is fully sequence verified and matched to NCBI accession ID: NM_021643 |
TRIB2 ORF Vector (Human) (pORF) |
ORF010953 |
ABM |
1.0 ug DNA |
EUR 95 |
Trib2 ORF Vector (Mouse) (pORF) |
ORF060344 |
ABM |
1.0 ug DNA |
EUR 506 |
Trib2 sgRNA CRISPR Lentivector set (Rat) |
K6050001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Trib2 sgRNA CRISPR Lentivector set (Mouse) |
K4676101 |
ABM |
3 x 1.0 ug |
EUR 339 |
TRIB2 sgRNA CRISPR Lentivector set (Human) |
K2462701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Tribbles Homolog 2 (TRIB2) ELISA Kit |
abx383918-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Trib2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6050002 |
ABM |
1.0 ug DNA |
EUR 154 |
Trib2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6050003 |
ABM |
1.0 ug DNA |
EUR 154 |
Trib2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6050004 |
ABM |
1.0 ug DNA |
EUR 154 |
Trib2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4676102 |
ABM |
1.0 ug DNA |
EUR 154 |
Trib2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4676103 |
ABM |
1.0 ug DNA |
EUR 154 |
Trib2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4676104 |
ABM |
1.0 ug DNA |
EUR 154 |
TRIB2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2462702 |
ABM |
1.0 ug DNA |
EUR 154 |
TRIB2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2462703 |
ABM |
1.0 ug DNA |
EUR 154 |
TRIB2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2462704 |
ABM |
1.0 ug DNA |
EUR 154 |
TRIB2 Protein Vector (Rat) (pPB-C-His) |
PV312838 |
ABM |
500 ng |
EUR 603 |
TRIB2 Protein Vector (Rat) (pPB-N-His) |
PV312839 |
ABM |
500 ng |
EUR 603 |
TRIB2 Protein Vector (Rat) (pPM-C-HA) |
PV312840 |
ABM |
500 ng |
EUR 603 |
TRIB2 Protein Vector (Rat) (pPM-C-His) |
PV312841 |
ABM |
500 ng |
EUR 603 |
TRIB2 Protein Vector (Mouse) (pPB-C-His) |
PV241374 |
ABM |
500 ng |
EUR 603 |
TRIB2 Protein Vector (Mouse) (pPB-N-His) |
PV241375 |
ABM |
500 ng |
EUR 603 |
TRIB2 Protein Vector (Mouse) (pPM-C-HA) |
PV241376 |
ABM |
500 ng |
EUR 603 |
TRIB2 Protein Vector (Mouse) (pPM-C-His) |
PV241377 |
ABM |
500 ng |
EUR 603 |
TRIB2 Protein Vector (Human) (pPB-C-His) |
PV043809 |
ABM |
500 ng |
EUR 329 |
TRIB2 Protein Vector (Human) (pPB-N-His) |
PV043810 |
ABM |
500 ng |
EUR 329 |
TRIB2 Protein Vector (Human) (pPM-C-HA) |
PV043811 |
ABM |
500 ng |
EUR 329 |
TRIB2 Protein Vector (Human) (pPM-C-His) |
PV043812 |
ABM |
500 ng |
EUR 329 |
Trib2 3'UTR Luciferase Stable Cell Line |
TU121069 |
ABM |
1.0 ml |
Ask for price |
Trib2 3'UTR GFP Stable Cell Line |
TU171069 |
ABM |
1.0 ml |
Ask for price |
Trib2 3'UTR Luciferase Stable Cell Line |
TU222418 |
ABM |
1.0 ml |
Ask for price |
TRIB2 3'UTR GFP Stable Cell Line |
TU076510 |
ABM |
1.0 ml |
EUR 1521 |
TRIB2 3'UTR Luciferase Stable Cell Line |
TU026510 |
ABM |
1.0 ml |
EUR 1521 |
Trib2 3'UTR GFP Stable Cell Line |
TU272418 |
ABM |
1.0 ml |
Ask for price |
TRIB2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV700123 |
ABM |
1.0 ug DNA |
EUR 514 |
TRIB2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV700127 |
ABM |
1.0 ug DNA |
EUR 514 |
TRIB2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV700128 |
ABM |
1.0 ug DNA |
EUR 514 |
TRIB2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV793141 |
ABM |
1.0 ug DNA |
EUR 316 |
TRIB2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV793142 |
ABM |
1.0 ug DNA |
EUR 316 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
TRIB2 Rabbit Polyclonal Antibody