TRIB3 Rabbit Polyclonal Antibody

TRIB3 Rabbit Polyclonal Antibody

TRIB3 Polyclonal Antibody

ABP60758-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TRIB3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRIB3 from Human. This TRIB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRIB3 protein

TRIB3 Polyclonal Antibody

ABP60758-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TRIB3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRIB3 from Human. This TRIB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRIB3 protein

TRIB3 Polyclonal Antibody

ABP60758-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TRIB3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRIB3 from Human. This TRIB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRIB3 protein

TRIB3 Rabbit pAb

A5424-100ul 100 ul
EUR 308

TRIB3 Rabbit pAb

A5424-200ul 200 ul
EUR 459

TRIB3 Rabbit pAb

A5424-20ul 20 ul
EUR 183

TRIB3 Rabbit pAb

A5424-50ul 50 ul
EUR 223

TRIB3 Rabbit pAb

A2346-100ul 100 ul
EUR 308

TRIB3 Rabbit pAb

A2346-200ul 200 ul
EUR 459

TRIB3 Rabbit pAb

A2346-20ul 20 ul Ask for price

TRIB3 Rabbit pAb

A2346-50ul 50 ul Ask for price

TRIB3 antibody

70R-51057 100 ul
EUR 244
Description: Purified Polyclonal TRIB3 antibody

TRIB3 antibody

70R-3572 50 ug
EUR 467
Description: Rabbit polyclonal TRIB3 antibody

TRIB3 antibody

70R-20973 50 ul
EUR 435
Description: Rabbit polyclonal TRIB3 antibody

TRIB3 Antibody

ABD7844 100 ug
EUR 438

TRIB3 Antibody

40167-100ul 100ul
EUR 252

TRIB3 Antibody

DF7844 200ul
EUR 304
Description: TRIB3 Antibody detects endogenous levels of total TRIB3.

TRIB3 Antibody

1-CSB-PA847220LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TRIB3 Antibody

1-CSB-PA592034
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TRIB3 Antibody

1-CSB-PA120599
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TRIB3 Antibody

1-CSB-PA024446GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal TRB3 / TRIB3 Antibody (Internal)

APR03193G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal TRIB3 Antibody (C-term)

APR06077G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIB3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TRB3 / TRIB3 Antibody (N-Terminus)

APR02010G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TRB3 / TRIB3 Antibody (C-Terminus)

APR02015G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (C-Terminus). This antibody is tested and proven to work in the following applications:

TRIB3 Conjugated Antibody

C40167 100ul
EUR 397

anti- TRIB3 antibody

FNab08966 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • Immunogen: tribbles homolog 3(Drosophila)
  • Uniprot ID: Q96RU7
  • Gene ID: 57761
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against TRIB3

Anti-TRIB3 antibody

PAab08966 100 ug
EUR 386

Anti-TRIB3 antibody

STJ25963 100 µl
EUR 277
Description: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants.

Anti-TRIB3 antibody

STJ27377 100 µl
EUR 277
Description: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants.

Anti-TRIB3 antibody

STJ191991 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRIB3

Trib3/ Rat Trib3 ELISA Kit

ELI-51153r 96 Tests
EUR 886

TRIB3 siRNA

20-abx905776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRIB3 siRNA

20-abx938004
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRIB3 siRNA

20-abx938005
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TRIB3

YF-PA20284 50 ug
EUR 363
Description: Mouse polyclonal to TRIB3

anti-TRIB3

YF-PA20285 100 ug
EUR 403
Description: Rabbit polyclonal to TRIB3

TRIB3 Antibody, HRP conjugated

1-CSB-PA847220LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRIB3 Antibody, FITC conjugated

1-CSB-PA847220LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TRIB3 Antibody, Biotin conjugated

1-CSB-PA847220LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TRIB3 Monoclonal Antibody

M01414 100ug
EUR 397
Description: Rabbit Monoclonal TRIB3 Antibody. Validated in IP, WB and tested in Human.

TRIB3 Blocking Peptide

20-abx063932
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TRIB3 Blocking Peptide

33R-10278 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIB3 antibody, catalog no. 70R-3572

TRIB3 Blocking Peptide

DF7844-BP 1mg
EUR 195

TRIB3 cloning plasmid

CSB-CL847220HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1077
  • Sequence: atgcgagccacccctctggctgctcctgcgggttccctgtccaggaagaagcggttggagttggatgacaacttagataccgagcgtcccgtccagaaacgagctcgaagtgggccccagcccagactgcccccctgcctgttgcccctgagcccacctactgctccagatcgtg
  • Show more
Description: A cloning plasmid for the TRIB3 gene.

Anti-TRIB3 (1H2)

YF-MA19104 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Anti-TRIB3 (2G5)

YF-MA19105 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Anti-TRIB3 (3D7)

YF-MA19106 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Anti-TRIB3 (2D1)

YF-MA19107 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Anti-TRIB3 (2F7)

YF-MA11617 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Monoclonal TRIB3 Antibody, Clone: EPR3150

APR13800G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TRIB3. The antibodies are raised in Rabbit and are from clone EPR3150. This antibody is applicable in WB

Tribbles Homolog 3 (TRIB3) Antibody

20-abx001903
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

abx145410-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

abx033920-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

abx033920-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

20-abx006614
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

20-abx008081
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

abx238966-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tribbles Homolog 3 (TRIB3) Antibody

20-abx301787
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

20-abx210281
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

20-abx210462
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody (HRP)

20-abx314602
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody (FITC)

20-abx314603
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody (Biotin)

20-abx314604
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat TRIB3 shRNA Plasmid

20-abx987973
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TRIB3 ELISA Kit

ELA-E9844h 96 Tests
EUR 824

TRIB3 ELISA KIT|Human

EF006551 96 Tests
EUR 689

TRIB3 protein (His tag)

80R-4057 50 ug
EUR 327
Description: Recombinant Human TRIB3 protein (His tag)

Mouse TRIB3 shRNA Plasmid

20-abx981648
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TRIB3 shRNA Plasmid

20-abx961670
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TRIB3 Recombinant Protein (Human)

RP032860 100 ug Ask for price

TRIB3 Recombinant Protein (Rat)

RP234629 100 ug Ask for price

TRIB3 Recombinant Protein (Mouse)

RP181031 100 ug Ask for price

pCMV-SPORT6-TRIB3 Plasmid

PVT16467 2 ug
EUR 325

Monoclonal TRIB3 Antibody (monoclonal) (M03), Clone: 1H2

AMM04244G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TRIB3 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1H2. This antibody is applicable in WB and IF

Monoclonal TRIB3 Antibody (monoclonal) (M06), Clone: 2G5

AMM04245G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TRIB3 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 2G5. This antibody is applicable in WB and IF, E

h TRIB3 inducible lentiviral particles

LVP128 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, TRIB3, is fully sequence verified and matched to NCBI accession ID: NM_021158

Trib3 ORF Vector (Rat) (pORF)

ORF078211 1.0 ug DNA
EUR 506

TRIB3 ORF Vector (Human) (pORF)

ORF010954 1.0 ug DNA
EUR 95

Trib3 ORF Vector (Mouse) (pORF)

ORF060345 1.0 ug DNA
EUR 506

TRIB3 sgRNA CRISPR Lentivector set (Human)

K2462801 3 x 1.0 ug
EUR 339

Trib3 sgRNA CRISPR Lentivector set (Mouse)

K4286101 3 x 1.0 ug
EUR 339

Trib3 sgRNA CRISPR Lentivector set (Rat)

K7247001 3 x 1.0 ug
EUR 339

Cow Tribbles Homolog 3 (TRIB3) ELISA Kit

abx521350-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Tribbles Homolog 3 (TRIB3) ELISA Kit

abx521352-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Tribbles Homolog 3 (TRIB3) ELISA Kit

abx521353-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human TRIB3/ Tribbles homolog 3 ELISA Kit

E2588Hu 1 Kit
EUR 605

Human TRIB3(Tribbles homolog 3) ELISA Kit

EH2519 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q96RU7
  • Alias: TRIB3/Tribbles homolog 3(TRB-3)/p65-interacting inhibitor of NF-kappa-B/Neuronal cell death-inducible putative kinase/SINK
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Tribbles homolog 3, Trib3 ELISA KIT

ELI-23158m 96 Tests
EUR 865

Human Tribbles homolog 3, TRIB3 ELISA KIT

ELI-36572h 96 Tests
EUR 824

TRIB3 Rabbit Polyclonal Antibody