TRIB3 Rabbit Polyclonal Antibody
TRIB3 Polyclonal Antibody |
ABP60758-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TRIB3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TRIB3 from Human. This TRIB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRIB3 protein |
TRIB3 Polyclonal Antibody |
ES10833-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TRIB3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TRIB3 Polyclonal Antibody |
ES10833-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TRIB3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TRIB3 Rabbit pAb |
A5424-100ul |
Abclonal |
100 ul |
EUR 308 |
TRIB3 Rabbit pAb |
A5424-200ul |
Abclonal |
200 ul |
EUR 459 |
TRIB3 Rabbit pAb |
A5424-20ul |
Abclonal |
20 ul |
EUR 183 |
TRIB3 Rabbit pAb |
A5424-50ul |
Abclonal |
50 ul |
EUR 223 |
TRIB3 Rabbit pAb |
A2346-100ul |
Abclonal |
100 ul |
EUR 308 |
TRIB3 Rabbit pAb |
A2346-200ul |
Abclonal |
200 ul |
EUR 459 |
TRIB3 Rabbit pAb |
A2346-20ul |
Abclonal |
20 ul |
Ask for price |
TRIB3 Rabbit pAb |
A2346-50ul |
Abclonal |
50 ul |
Ask for price |
TRIB3 antibody |
70R-20973 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TRIB3 antibody |
TRIB3 Antibody |
40167-100ul |
SAB |
100ul |
EUR 252 |
TRIB3 Antibody |
1-CSB-PA847220LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
TRIB3 Antibody |
1-CSB-PA120599 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
TRIB3 Antibody |
DF7844 |
Affbiotech |
200ul |
EUR 304 |
Description: TRIB3 Antibody detects endogenous levels of total TRIB3. |
TRIB3 Antibody |
1-CSB-PA592034 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150 |
TRIB3 antibody |
70R-3572 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TRIB3 antibody |
TRIB3 antibody |
70R-51057 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal TRIB3 antibody |
TRIB3 Antibody |
1-CSB-PA024446GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal TRB3 / TRIB3 Antibody (Internal) |
APR03193G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (Internal). This antibody is tested and proven to work in the following applications: |
Polyclonal TRIB3 Antibody (C-term) |
APR06077G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIB3 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal TRB3 / TRIB3 Antibody (N-Terminus) |
APR02010G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (N-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal TRB3 / TRIB3 Antibody (C-Terminus) |
APR02015G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (C-Terminus). This antibody is tested and proven to work in the following applications: |
TRIB3 Conjugated Antibody |
C40167 |
SAB |
100ul |
EUR 397 |
anti- TRIB3 antibody |
FNab08966 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- IP: 1:200-1:2000
- Immunogen: tribbles homolog 3(Drosophila)
- Uniprot ID: Q96RU7
- Gene ID: 57761
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against TRIB3 |
Anti-TRIB3 antibody |
STJ25963 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants. |
Anti-TRIB3 antibody |
STJ27377 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants. |
Anti-TRIB3 antibody |
STJ191991 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TRIB3 |
TRIB3 siRNA |
20-abx905776 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRIB3 siRNA |
20-abx938004 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRIB3 siRNA |
20-abx938005 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TRIB3 |
YF-PA20284 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to TRIB3 |
anti-TRIB3 |
YF-PA20285 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to TRIB3 |
TRIB3 Antibody, HRP conjugated |
1-CSB-PA847220LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TRIB3 Antibody, FITC conjugated |
1-CSB-PA847220LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TRIB3 Antibody, Biotin conjugated |
1-CSB-PA847220LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-TRIB3 Monoclonal Antibody |
M01414 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal TRIB3 Antibody. Validated in IP, WB and tested in Human. |
TRIB3 Blocking Peptide |
33R-10278 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIB3 antibody, catalog no. 70R-3572 |
TRIB3 Blocking Peptide |
DF7844-BP |
Affbiotech |
1mg |
EUR 195 |
TRIB3 Blocking Peptide |
20-abx063932 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRIB3 cloning plasmid |
CSB-CL847220HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1077
- Sequence: atgcgagccacccctctggctgctcctgcgggttccctgtccaggaagaagcggttggagttggatgacaacttagataccgagcgtcccgtccagaaacgagctcgaagtgggccccagcccagactgcccccctgcctgttgcccctgagcccacctactgctccagatcgtg
- Show more
|
Description: A cloning plasmid for the TRIB3 gene. |
Anti-TRIB3 (2F7) |
YF-MA11617 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRIB3 |
Anti-TRIB3 (1H2) |
YF-MA19104 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRIB3 |
Anti-TRIB3 (2G5) |
YF-MA19105 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRIB3 |
Anti-TRIB3 (3D7) |
YF-MA19106 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRIB3 |
Anti-TRIB3 (2D1) |
YF-MA19107 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRIB3 |
Tribbles Homolog 3 (TRIB3) Antibody |
20-abx008081 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
20-abx006614 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
20-abx210281 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
20-abx210462 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
abx145410-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
abx033920-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
abx033920-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
abx238966-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Monoclonal TRIB3 Antibody, Clone: EPR3150 |
APR13800G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human TRIB3. The antibodies are raised in Rabbit and are from clone EPR3150. This antibody is applicable in WB |
Tribbles Homolog 3 (TRIB3) Antibody |
20-abx301787 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
20-abx001903 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody (HRP) |
20-abx314602 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody (FITC) |
20-abx314603 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody (Biotin) |
20-abx314604 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
TRIB3 protein (His tag) |
80R-4057 |
Fitzgerald |
50 ug |
EUR 327 |
Description: Recombinant Human TRIB3 protein (His tag) |
Rat TRIB3 shRNA Plasmid |
20-abx987973 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse TRIB3 shRNA Plasmid |
20-abx981648 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TRIB3 shRNA Plasmid |
20-abx961670 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TRIB3 Recombinant Protein (Rat) |
RP234629 |
ABM |
100 ug |
Ask for price |
TRIB3 Recombinant Protein (Human) |
RP032860 |
ABM |
100 ug |
Ask for price |
TRIB3 Recombinant Protein (Mouse) |
RP181031 |
ABM |
100 ug |
Ask for price |
Monoclonal TRIB3 Antibody (monoclonal) (M03), Clone: 1H2 |
AMM04244G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human TRIB3 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1H2. This antibody is applicable in WB and IF |
Monoclonal TRIB3 Antibody (monoclonal) (M06), Clone: 2G5 |
AMM04245G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human TRIB3 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 2G5. This antibody is applicable in WB and IF, E |
Trib3 ORF Vector (Rat) (pORF) |
ORF078211 |
ABM |
1.0 ug DNA |
EUR 506 |
h TRIB3 inducible lentiviral particles |
LVP128 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, TRIB3, is fully sequence verified and matched to NCBI accession ID: NM_021158 |
TRIB3 ORF Vector (Human) (pORF) |
ORF010954 |
ABM |
1.0 ug DNA |
EUR 95 |
Trib3 ORF Vector (Mouse) (pORF) |
ORF060345 |
ABM |
1.0 ug DNA |
EUR 506 |
TRIB3 ELISA Kit (Rat) (OKCA02608) |
OKCA02608 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Disrupts insulin signaling by binding directly to Akt kinases and blocking their activation. May bind directly to and mask the 'Thr-308' phosphorylation site in AKT1. Binds to ATF4 and inhibits its transcriptional activation activity. Interacts with the NF-kappa-B transactivator p65 RELA and inhibits its phosphorylation and thus its transcriptional activation activity. Interacts with MAPK kinases and regulates activation of MAP kinases. May play a role in programmed neuronal cell death but does not appear to affect non-neuronal cells. Does not display kinase activity. Inhibits the transcriptional activity of DDIT3/CHOP and is involved in DDIT3/CHOP-dependent cell death during ER stress. Can inhibit APOBEC3A editing of nuclear DNA.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 10.1 pg/mL |
Trib3 sgRNA CRISPR Lentivector set (Rat) |
K7247001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Trib3 sgRNA CRISPR Lentivector set (Mouse) |
K4286101 |
ABM |
3 x 1.0 ug |
EUR 339 |
TRIB3 sgRNA CRISPR Lentivector set (Human) |
K2462801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Tribbles homolog 3(TRIB3) ELISA kit |
CSB-EL024446HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Tribbles homolog 3 (TRIB3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Tribbles homolog 3(TRIB3) ELISA kit |
1-CSB-EL024446HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Tribbles homolog 3(TRIB3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Tribbles homolog 3 (TRIB3) ELISA Kit |
abx251890-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human TRIB3(Tribbles homolog 3) ELISA Kit |
EH2519 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q96RU7
- Alias: TRIB3/Tribbles homolog 3(TRB-3)/p65-interacting inhibitor of NF-kappa-B/Neuronal cell death-inducible putative kinase/SINK
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human TRIB3/ Tribbles homolog 3 ELISA Kit |
E2588Hu |
Sunlong |
1 Kit |
EUR 605 |
TRIB3 Rabbit Polyclonal Antibody