UBE2H Rabbit Polyclonal Antibody
UBE2H Polyclonal Antibody |
ABP60820-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human UBE2H protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBE2H from Human, Mouse. This UBE2H antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2H protein |
UBE2H Polyclonal Antibody |
ABP60820-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human UBE2H protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBE2H from Human, Mouse. This UBE2H antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2H protein |
UBE2H Polyclonal Antibody |
30894-100ul |
SAB |
100ul |
EUR 252 |
UBE2H Polyclonal Antibody |
30894-50ul |
SAB |
50ul |
EUR 187 |
UBE2H Rabbit pAb |
A7344-100ul |
Abclonal |
100 ul |
EUR 308 |
UBE2H Rabbit pAb |
A7344-200ul |
Abclonal |
200 ul |
EUR 459 |
UBE2H Rabbit pAb |
A7344-20ul |
Abclonal |
20 ul |
EUR 183 |
UBE2H Rabbit pAb |
A7344-50ul |
Abclonal |
50 ul |
EUR 223 |
UBE2H Polyclonal Conjugated Antibody |
C30894 |
SAB |
100ul |
EUR 397 |
UBE2H antibody |
70R-21106 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal UBE2H antibody |
UBE2H Antibody |
1-CSB-PA025455GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against UBE2H. Recognizes UBE2H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal Ube2h Antibody - N-terminal region |
APR00871G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ube2h - N-terminal region. This antibody is tested and proven to work in the following applications: |
anti- UBE2H antibody |
FNab09176 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:20-1:200
- Immunogen: ubiquitin-conjugating enzyme E2H
- Uniprot ID: P62256
- Gene ID: 7328
- Research Area: Epigenetics, Metabolism
|
Description: Antibody raised against UBE2H |
Human Ube2H Antibody |
33310-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-UBE2H antibody |
STJ29483 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein sequence is 100% identical to the mouse homolog and 98% identical to the frog and zebrafish homologs. Three alternatively spliced transcript variants have been found for this gene and they encode distinct isoforms. |
Anti-UBE2H antibody |
STJ191596 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to UBE2H |
UBE2H siRNA |
20-abx938780 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBE2H siRNA |
20-abx938781 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBE2H cloning plasmid |
CSB-CL025455HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 552
- Sequence: atgtcatctcccagtccgggcaagaggcggatggacacggacgtggtcaagctcatcgagagtaaacatgaggttacgatcctgggaggacttaatgaatttgtagtgaagttttatggaccacaaggaacaccatatgaaggcggagtatggaaagttagagtggacctacctga
- Show more
|
Description: A cloning plasmid for the UBE2H gene. |
Human Ube2H Antibody (Biotin Conjugate) |
33310-05121 |
AssayPro |
150 ug |
EUR 369 |
Human UBE2H shRNA Plasmid |
20-abx955011 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
UBE2H protein (His tag) |
80R-2249 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Purified recombinant Human UBE2H Protein (His tag) |
Mouse UBE2H shRNA Plasmid |
20-abx973292 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
anti-UBE2H (3C4-1A2) |
LF-MA10365 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to UBE2H |
UBE2H Recombinant Protein (Human) |
RP033706 |
ABM |
100 ug |
Ask for price |
UBE2H Recombinant Protein (Rat) |
RP235556 |
ABM |
100 ug |
Ask for price |
UBE2H Recombinant Protein (Mouse) |
RP182654 |
ABM |
100 ug |
Ask for price |
UBE2H Recombinant Protein (Mouse) |
RP182657 |
ABM |
100 ug |
Ask for price |
UBE2H Recombinant Protein (Mouse) |
RP182660 |
ABM |
100 ug |
Ask for price |
Human Ube2H AssayLite Antibody (FITC Conjugate) |
33310-05141 |
AssayPro |
150 ug |
EUR 428 |
Human Ube2H AssayLite Antibody (RPE Conjugate) |
33310-05151 |
AssayPro |
150 ug |
EUR 428 |
Human Ube2H AssayLite Antibody (APC Conjugate) |
33310-05161 |
AssayPro |
150 ug |
EUR 428 |
Human Ube2H AssayLite Antibody (PerCP Conjugate) |
33310-05171 |
AssayPro |
150 ug |
EUR 471 |
Ubiquitin-Conjugating Enzyme E2 H (ube2h) Antibody |
20-abx116469 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody |
20-abx142292 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody |
20-abx006923 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody |
abx029157-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody |
abx029157-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Ubiquitin-Conjugating Enzyme E2 H (UBE2H) Antibody |
abx239176-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Ube2h ORF Vector (Rat) (pORF) |
ORF078520 |
ABM |
1.0 ug DNA |
EUR 506 |
UBE2H ORF Vector (Human) (pORF) |
ORF011236 |
ABM |
1.0 ug DNA |
EUR 95 |
Ube2h ORF Vector (Mouse) (pORF) |
ORF060886 |
ABM |
1.0 ug DNA |
EUR 506 |
Ube2h ORF Vector (Mouse) (pORF) |
ORF060887 |
ABM |
1.0 ug DNA |
EUR 506 |
Ube2h ORF Vector (Mouse) (pORF) |
ORF060888 |
ABM |
1.0 ug DNA |
EUR 506 |
Monoclonal UBE2H Antibody (monoclonal) (M01), Clone: 3C4-1A2 |
AMM04278G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human UBE2H (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3C4-1A2. This antibody is applicable in WB and IF, E |
UBE2H sgRNA CRISPR Lentivector set (Human) |
K2572101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ube2h sgRNA CRISPR Lentivector set (Mouse) |
K4746401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ube2h sgRNA CRISPR Lentivector set (Rat) |
K6090601 |
ABM |
3 x 1.0 ug |
EUR 339 |
UBE2H sgRNA CRISPR Lentivector (Human) (Target 1) |
K2572102 |
ABM |
1.0 ug DNA |
EUR 154 |
UBE2H Rabbit Polyclonal Antibody