UBXN4 Rabbit Polyclonal Antibody

UBXN4 Rabbit Polyclonal Antibody

UBXN4 antibody

70R-21136 50 ul
EUR 435
Description: Rabbit polyclonal UBXN4 antibody

UBXN4 Antibody

1-CSB-PA025536GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBXN4. Recognizes UBXN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

Ubxn4/ Rat Ubxn4 ELISA Kit

ELI-28563r 96 Tests
EUR 886

Anti-UBXN4 antibody

STJ191606 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBXN4

UBXN4 siRNA

20-abx905927
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBXN4 siRNA

20-abx938898
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBXN4 siRNA

20-abx938899
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBXN4 cloning plasmid

CSB-CL842131HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1527
  • Sequence: atgctgtggttccagggcgccattccggccgccatcgcgacggccaaaaggagcggcgcggtcttcgtggtgttcgtggcaggtgatgatgaacagtctacacagatggctgcaagttgggaagatgataaagttacagaagcatcttcaaacagttttgttgctattaaaatcg
  • Show more
Description: A cloning plasmid for the UBXN4 gene.

UBXN4 cloning plasmid

CSB-CL842131HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 288
  • Sequence: atgctgtggttccagggcgccattccggccgccatcgcgacggccaaaaggagcggcgcggtcttcgtggtgttcgtggcaggtgatgatgaacagtctacacagatggctgcaagttgggaagatgataaagttacagaagcatcttcaaacagttttgttgctattaaaatcga
  • Show more
Description: A cloning plasmid for the UBXN4 gene.

Rat UBXN4 shRNA Plasmid

20-abx989286
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse UBXN4 shRNA Plasmid

20-abx976333
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human UBXN4 shRNA Plasmid

20-abx958070
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UBXN4 Recombinant Protein (Rat)

RP235700 100 ug Ask for price

UBXN4 Recombinant Protein (Human)

RP033847 100 ug Ask for price

UBXN4 Recombinant Protein (Human)

RP033850 100 ug Ask for price

UBXN4 Recombinant Protein (Mouse)

RP182891 100 ug Ask for price

UBX Domain-Containing Protein 4 (UBXN4) Antibody

20-abx116497
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubxn4 ORF Vector (Mouse) (pORF)

ORF060965 1.0 ug DNA
EUR 506

Ubxn4 ORF Vector (Rat) (pORF)

ORF078568 1.0 ug DNA
EUR 506

UBXN4 ORF Vector (Human) (pORF)

ORF011283 1.0 ug DNA
EUR 95

UBXN4 ORF Vector (Human) (pORF)

ORF011284 1.0 ug DNA
EUR 95

Ubxn4 sgRNA CRISPR Lentivector set (Rat)

K6405701 3 x 1.0 ug
EUR 339

UBXN4 sgRNA CRISPR Lentivector set (Human)

K2580001 3 x 1.0 ug
EUR 339

Ubxn4 sgRNA CRISPR Lentivector set (Mouse)

K4020501 3 x 1.0 ug
EUR 339

Ubxn4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6405702 1.0 ug DNA
EUR 154

Ubxn4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6405703 1.0 ug DNA
EUR 154

Ubxn4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6405704 1.0 ug DNA
EUR 154

UBXN4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2580002 1.0 ug DNA
EUR 154

UBXN4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2580003 1.0 ug DNA
EUR 154

UBXN4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2580004 1.0 ug DNA
EUR 154

Ubxn4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4020502 1.0 ug DNA
EUR 154

Ubxn4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4020503 1.0 ug DNA
EUR 154

Ubxn4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4020504 1.0 ug DNA
EUR 154

UBXN4 Protein Vector (Mouse) (pPB-C-His)

PV243858 500 ng
EUR 603

UBXN4 Protein Vector (Mouse) (pPB-N-His)

PV243859 500 ng
EUR 603

UBXN4 Protein Vector (Mouse) (pPM-C-HA)

PV243860 500 ng
EUR 603

UBXN4 Protein Vector (Mouse) (pPM-C-His)

PV243861 500 ng
EUR 603

UBXN4 Protein Vector (Rat) (pPB-C-His)

PV314270 500 ng
EUR 603

UBXN4 Protein Vector (Rat) (pPB-N-His)

PV314271 500 ng
EUR 603

UBXN4 Protein Vector (Rat) (pPM-C-HA)

PV314272 500 ng
EUR 603

UBXN4 Protein Vector (Rat) (pPM-C-His)

PV314273 500 ng
EUR 603

UBXN4 Protein Vector (Human) (pPB-C-His)

PV045129 500 ng
EUR 329

UBXN4 Protein Vector (Human) (pPB-N-His)

PV045130 500 ng
EUR 329

UBXN4 Protein Vector (Human) (pPM-C-HA)

PV045131 500 ng
EUR 329

UBXN4 Protein Vector (Human) (pPM-C-His)

PV045132 500 ng
EUR 329

UBXN4 Protein Vector (Human) (pPB-C-His)

PV045133 500 ng
EUR 329

UBXN4 Protein Vector (Human) (pPB-N-His)

PV045134 500 ng
EUR 329

UBXN4 Protein Vector (Human) (pPM-C-HA)

PV045135 500 ng
EUR 329

UBXN4 Protein Vector (Human) (pPM-C-His)

PV045136 500 ng
EUR 329

Ubxn4 3'UTR Luciferase Stable Cell Line

TU121517 1.0 ml Ask for price

UBXN4 3'UTR GFP Stable Cell Line

TU077745 1.0 ml
EUR 1521

Ubxn4 3'UTR GFP Stable Cell Line

TU171517 1.0 ml Ask for price

Ubxn4 3'UTR Luciferase Stable Cell Line

TU222804 1.0 ml Ask for price

UBXN4 3'UTR Luciferase Stable Cell Line

TU027745 1.0 ml
EUR 1521

Ubxn4 3'UTR GFP Stable Cell Line

TU272804 1.0 ml Ask for price

UBXN4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV716595 1.0 ug DNA
EUR 316

UBXN4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV716599 1.0 ug DNA
EUR 316

UBXN4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV716600 1.0 ug DNA
EUR 316

UBXN4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV694549 1.0 ug DNA
EUR 682

UBXN4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV694553 1.0 ug DNA
EUR 682

UBXN4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV694554 1.0 ug DNA
EUR 682

UBXN4 Rabbit Polyclonal Antibody