Da vinci european bio bank

UBXN4 Rabbit Polyclonal Antibody

UBXN4 antibody
70R-21136	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal UBXN4 antibody

UBXN4 Antibody
1-CSB-PA025536GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBXN4. Recognizes UBXN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

Ubxn4/ Rat Ubxn4 ELISA Kit
ELI-28563r	Lifescience Market	96 Tests	EUR 886

Anti-UBXN4 antibody
STJ191606	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to UBXN4

UBXN4 siRNA
20-abx905927	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UBXN4 siRNA
20-abx938898	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UBXN4 siRNA
20-abx938899	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UBXN4 cloning plasmid
CSB-CL842131HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1527 Sequence: atgctgtggttccagggcgccattccggccgccatcgcgacggccaaaaggagcggcgcggtcttcgtggtgttcgtggcaggtgatgatgaacagtctacacagatggctgcaagttgggaagatgataaagttacagaagcatcttcaaacagttttgttgctattaaaatcg Show more
Description: A cloning plasmid for the UBXN4 gene.

UBXN4 cloning plasmid
CSB-CL842131HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 288 Sequence: atgctgtggttccagggcgccattccggccgccatcgcgacggccaaaaggagcggcgcggtcttcgtggtgttcgtggcaggtgatgatgaacagtctacacagatggctgcaagttgggaagatgataaagttacagaagcatcttcaaacagttttgttgctattaaaatcga Show more
Description: A cloning plasmid for the UBXN4 gene.

Rat UBXN4 shRNA Plasmid
20-abx989286	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse UBXN4 shRNA Plasmid
20-abx976333	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human UBXN4 shRNA Plasmid
20-abx958070	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UBXN4 Recombinant Protein (Rat)
RP235700	ABM	100 ug	Ask for price

UBXN4 Recombinant Protein (Human)
RP033847	ABM	100 ug	Ask for price

UBXN4 Recombinant Protein (Human)
RP033850	ABM	100 ug	Ask for price

UBXN4 Recombinant Protein (Mouse)
RP182891	ABM	100 ug	Ask for price

UBX Domain-Containing Protein 4 (UBXN4) Antibody
20-abx116497	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ubxn4 ORF Vector (Mouse) (pORF)
ORF060965	ABM	1.0 ug DNA	EUR 506

Ubxn4 ORF Vector (Rat) (pORF)
ORF078568	ABM	1.0 ug DNA	EUR 506

UBXN4 ORF Vector (Human) (pORF)
ORF011283	ABM	1.0 ug DNA	EUR 95

UBXN4 ORF Vector (Human) (pORF)
ORF011284	ABM	1.0 ug DNA	EUR 95

Ubxn4 sgRNA CRISPR Lentivector set (Rat)
K6405701	ABM	3 x 1.0 ug	EUR 339

UBXN4 sgRNA CRISPR Lentivector set (Human)
K2580001	ABM	3 x 1.0 ug	EUR 339

Ubxn4 sgRNA CRISPR Lentivector set (Mouse)
K4020501	ABM	3 x 1.0 ug	EUR 339

Ubxn4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6405702	ABM	1.0 ug DNA	EUR 154

Ubxn4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6405703	ABM	1.0 ug DNA	EUR 154

Ubxn4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6405704	ABM	1.0 ug DNA	EUR 154

UBXN4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2580002	ABM	1.0 ug DNA	EUR 154

UBXN4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2580003	ABM	1.0 ug DNA	EUR 154

UBXN4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2580004	ABM	1.0 ug DNA	EUR 154

Ubxn4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4020502	ABM	1.0 ug DNA	EUR 154

Ubxn4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4020503	ABM	1.0 ug DNA	EUR 154

Ubxn4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4020504	ABM	1.0 ug DNA	EUR 154

UBXN4 Protein Vector (Mouse) (pPB-C-His)
PV243858	ABM	500 ng	EUR 603

UBXN4 Protein Vector (Mouse) (pPB-N-His)
PV243859	ABM	500 ng	EUR 603

UBXN4 Protein Vector (Mouse) (pPM-C-HA)
PV243860	ABM	500 ng	EUR 603

UBXN4 Protein Vector (Mouse) (pPM-C-His)
PV243861	ABM	500 ng	EUR 603

UBXN4 Protein Vector (Rat) (pPB-C-His)
PV314270	ABM	500 ng	EUR 603

UBXN4 Protein Vector (Rat) (pPB-N-His)
PV314271	ABM	500 ng	EUR 603

UBXN4 Protein Vector (Rat) (pPM-C-HA)
PV314272	ABM	500 ng	EUR 603

UBXN4 Protein Vector (Rat) (pPM-C-His)
PV314273	ABM	500 ng	EUR 603

UBXN4 Protein Vector (Human) (pPB-C-His)
PV045129	ABM	500 ng	EUR 329

UBXN4 Protein Vector (Human) (pPB-N-His)
PV045130	ABM	500 ng	EUR 329

UBXN4 Protein Vector (Human) (pPM-C-HA)
PV045131	ABM	500 ng	EUR 329

UBXN4 Protein Vector (Human) (pPM-C-His)
PV045132	ABM	500 ng	EUR 329

UBXN4 Protein Vector (Human) (pPB-C-His)
PV045133	ABM	500 ng	EUR 329

UBXN4 Protein Vector (Human) (pPB-N-His)
PV045134	ABM	500 ng	EUR 329

UBXN4 Protein Vector (Human) (pPM-C-HA)
PV045135	ABM	500 ng	EUR 329

UBXN4 Protein Vector (Human) (pPM-C-His)
PV045136	ABM	500 ng	EUR 329

Ubxn4 3'UTR Luciferase Stable Cell Line
TU121517	ABM	1.0 ml	Ask for price

UBXN4 3'UTR GFP Stable Cell Line
TU077745	ABM	1.0 ml	EUR 1521

Ubxn4 3'UTR GFP Stable Cell Line
TU171517	ABM	1.0 ml	Ask for price

Ubxn4 3'UTR Luciferase Stable Cell Line
TU222804	ABM	1.0 ml	Ask for price

UBXN4 3'UTR Luciferase Stable Cell Line
TU027745	ABM	1.0 ml	EUR 1521

Ubxn4 3'UTR GFP Stable Cell Line
TU272804	ABM	1.0 ml	Ask for price

UBXN4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV716595	ABM	1.0 ug DNA	EUR 316

UBXN4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV716599	ABM	1.0 ug DNA	EUR 316

UBXN4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV716600	ABM	1.0 ug DNA	EUR 316

UBXN4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV694549	ABM	1.0 ug DNA	EUR 682

UBXN4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV694553	ABM	1.0 ug DNA	EUR 682

UBXN4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV694554	ABM	1.0 ug DNA	EUR 682

UBXN4 Rabbit Polyclonal Antibody