UIMC1 Rabbit Polyclonal Antibody

UIMC1 Rabbit Polyclonal Antibody

UIMC1 Polyclonal Antibody

ABP60852-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UIMC1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UIMC1 from Human, Mouse, Rat. This UIMC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UIMC1 protein

UIMC1 Rabbit pAb

A7244-100ul 100 ul
EUR 308

UIMC1 Rabbit pAb

A7244-200ul 200 ul
EUR 459

UIMC1 Rabbit pAb

A7244-20ul 20 ul
EUR 183

UIMC1 Rabbit pAb

A7244-50ul 50 ul
EUR 223

UIMC1 Rabbit pAb

A4759-100ul 100 ul
EUR 308

UIMC1 Rabbit pAb

A4759-200ul 200 ul
EUR 459

UIMC1 Rabbit pAb

A4759-20ul 20 ul Ask for price

UIMC1 Rabbit pAb

A4759-50ul 50 ul Ask for price

UIMC1 Rabbit pAb

A14512-100ul 100 ul
EUR 308

UIMC1 Rabbit pAb

A14512-200ul 200 ul
EUR 459

UIMC1 Rabbit pAb

A14512-20ul 20 ul
EUR 183

UIMC1 Rabbit pAb

A14512-50ul 50 ul
EUR 223

UIMC1 antibody

70R-21163 50 ul
EUR 435
Description: Rabbit polyclonal UIMC1 antibody

UIMC1 Antibody

ABD8264 100 ug
EUR 438

UIMC1 antibody

39191-100ul 100ul
EUR 252

UIMC1 Antibody

DF8264 200ul
EUR 304
Description: UIMC1 Antibody detects endogenous levels of total UIMC1.

UIMC1 Antibody

1-CSB-PA857019LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UIMC1. Recognizes UIMC1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000

UIMC1 Antibody

1-CSB-PA025608GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UIMC1. Recognizes UIMC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

UIMC1 Conjugated Antibody

C39191 100ul
EUR 397

anti- UIMC1 antibody

FNab09247 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:200-1:2000;IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: ubiquitin interaction motif containing 1
  • Uniprot ID: Q96RL1
  • Gene ID: 51720
  • Research Area: Metabolism
Description: Antibody raised against UIMC1

Anti-UIMC1 antibody

PAab09247 100 ug
EUR 412

Anti-UIMC1 antibody

STJ29387 100 µl
EUR 277
Description: This gene encodes a nuclear protein that interacts with Brca1 (breast cancer 1) in a complex to recognize and repair DNA lesions. This protein binds ubiquitinated lysine 63 of histone H2A and H2AX. This protein may also function as a repressor of transcription. Alternative splicing results in multiple transcript variants.

Anti-UIMC1 antibody

STJ26042 100 µl
EUR 277
Description: This gene encodes a nuclear protein that interacts with Brca1 (breast cancer 1) in a complex to recognize and repair DNA lesions. This protein binds ubiquitinated lysine 63 of histone H2A and H2AX. This protein may also function as a repressor of transcription. Alternative splicing results in multiple transcript variants.

Anti-UIMC1 antibody

STJ116723 100 µl
EUR 277
Description: This gene encodes a nuclear protein that interacts with Brca1 (breast cancer 1) in a complex to recognize and repair DNA lesions. This protein binds ubiquitinated lysine 63 of histone H2A and H2AX. This protein may also function as a repressor of transcription. Alternative splicing results in multiple transcript variants.

Anti-UIMC1 antibody

STJ191585 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UIMC1

Uimc1/ Rat Uimc1 ELISA Kit

ELI-39859r 96 Tests
EUR 886

UIMC1 siRNA

20-abx905949
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UIMC1 siRNA

20-abx939000
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UIMC1 siRNA

20-abx939001
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UIMC1 Antibody, HRP conjugated

1-CSB-PA857019LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UIMC1. Recognizes UIMC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UIMC1 Antibody, FITC conjugated

1-CSB-PA857019LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UIMC1. Recognizes UIMC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UIMC1 Antibody, Biotin conjugated

1-CSB-PA857019LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UIMC1. Recognizes UIMC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

UIMC1 cloning plasmid

CSB-CL857019HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1662
  • Sequence: atgccacggagaaagaaaaaagttaaagaagtctccgaatctcggaacctggagaagaaggatgtggaaactaccagttctgtcagtgtgaagaggaagcgtagacttgaggatgcattcattgtgatatccgatagtgatggagaggaaccaaaggaggaaaatgggttgcaga
  • Show more
Description: A cloning plasmid for the UIMC1 gene.

UIMC1 Blocking Peptide

DF8264-BP 1mg
EUR 195

Rat UIMC1 shRNA Plasmid

20-abx988479
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UIMC1 ELISA KIT|Human

EF004067 96 Tests
EUR 689

Human UIMC1 shRNA Plasmid

20-abx959917
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse UIMC1 shRNA Plasmid

20-abx972542
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UIMC1 Recombinant Protein (Human)

RP033955 100 ug Ask for price

UIMC1 Rabbit Polyclonal Antibody