UIMC1 Rabbit Polyclonal Antibody
UIMC1 Polyclonal Antibody |
ABP60852-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human UIMC1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UIMC1 from Human, Mouse, Rat. This UIMC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UIMC1 protein |
UIMC1 Rabbit pAb |
A7244-100ul |
Abclonal |
100 ul |
EUR 308 |
UIMC1 Rabbit pAb |
A7244-200ul |
Abclonal |
200 ul |
EUR 459 |
UIMC1 Rabbit pAb |
A7244-20ul |
Abclonal |
20 ul |
EUR 183 |
UIMC1 Rabbit pAb |
A7244-50ul |
Abclonal |
50 ul |
EUR 223 |
UIMC1 Rabbit pAb |
A4759-100ul |
Abclonal |
100 ul |
EUR 308 |
UIMC1 Rabbit pAb |
A4759-200ul |
Abclonal |
200 ul |
EUR 459 |
UIMC1 Rabbit pAb |
A4759-20ul |
Abclonal |
20 ul |
Ask for price |
UIMC1 Rabbit pAb |
A4759-50ul |
Abclonal |
50 ul |
Ask for price |
UIMC1 Rabbit pAb |
A14512-100ul |
Abclonal |
100 ul |
EUR 308 |
UIMC1 Rabbit pAb |
A14512-200ul |
Abclonal |
200 ul |
EUR 459 |
UIMC1 Rabbit pAb |
A14512-20ul |
Abclonal |
20 ul |
EUR 183 |
UIMC1 Rabbit pAb |
A14512-50ul |
Abclonal |
50 ul |
EUR 223 |
UIMC1 antibody |
70R-21163 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal UIMC1 antibody |
UIMC1 antibody |
39191-100ul |
SAB |
100ul |
EUR 252 |
UIMC1 Antibody |
DF8264 |
Affbiotech |
200ul |
EUR 304 |
Description: UIMC1 Antibody detects endogenous levels of total UIMC1. |
UIMC1 Antibody |
1-CSB-PA857019LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UIMC1. Recognizes UIMC1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000 |
UIMC1 Antibody |
1-CSB-PA025608GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against UIMC1. Recognizes UIMC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
UIMC1 Conjugated Antibody |
C39191 |
SAB |
100ul |
EUR 397 |
anti- UIMC1 antibody |
FNab09247 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:200-1:1000
- IP: 1:200-1:2000;IHC: 1:20-1:200
- IF: 1:10-1:100
- Immunogen: ubiquitin interaction motif containing 1
- Uniprot ID: Q96RL1
- Gene ID: 51720
- Research Area: Metabolism
|
Description: Antibody raised against UIMC1 |
Anti-UIMC1 antibody |
STJ29387 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nuclear protein that interacts with Brca1 (breast cancer 1) in a complex to recognize and repair DNA lesions. This protein binds ubiquitinated lysine 63 of histone H2A and H2AX. This protein may also function as a repressor of transcription. Alternative splicing results in multiple transcript variants. |
Anti-UIMC1 antibody |
STJ26042 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nuclear protein that interacts with Brca1 (breast cancer 1) in a complex to recognize and repair DNA lesions. This protein binds ubiquitinated lysine 63 of histone H2A and H2AX. This protein may also function as a repressor of transcription. Alternative splicing results in multiple transcript variants. |
Anti-UIMC1 antibody |
STJ116723 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nuclear protein that interacts with Brca1 (breast cancer 1) in a complex to recognize and repair DNA lesions. This protein binds ubiquitinated lysine 63 of histone H2A and H2AX. This protein may also function as a repressor of transcription. Alternative splicing results in multiple transcript variants. |
Anti-UIMC1 antibody |
STJ191585 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to UIMC1 |
UIMC1 siRNA |
20-abx905949 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UIMC1 siRNA |
20-abx939000 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UIMC1 siRNA |
20-abx939001 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UIMC1 Antibody, HRP conjugated |
1-CSB-PA857019LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UIMC1. Recognizes UIMC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UIMC1 Antibody, FITC conjugated |
1-CSB-PA857019LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UIMC1. Recognizes UIMC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UIMC1 Antibody, Biotin conjugated |
1-CSB-PA857019LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UIMC1. Recognizes UIMC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
UIMC1 cloning plasmid |
CSB-CL857019HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1662
- Sequence: atgccacggagaaagaaaaaagttaaagaagtctccgaatctcggaacctggagaagaaggatgtggaaactaccagttctgtcagtgtgaagaggaagcgtagacttgaggatgcattcattgtgatatccgatagtgatggagaggaaccaaaggaggaaaatgggttgcaga
- Show more
|
Description: A cloning plasmid for the UIMC1 gene. |
UIMC1 Blocking Peptide |
DF8264-BP |
Affbiotech |
1mg |
EUR 195 |
Rat UIMC1 shRNA Plasmid |
20-abx988479 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human UIMC1 shRNA Plasmid |
20-abx959917 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse UIMC1 shRNA Plasmid |
20-abx972542 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
UIMC1 Recombinant Protein (Human) |
RP033955 |
ABM |
100 ug |
Ask for price |
UIMC1 Rabbit Polyclonal Antibody