VAX2 Rabbit Polyclonal Antibody

VAX2 Rabbit Polyclonal Antibody

VAX2 Polyclonal Antibody

ABP60882-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VAX2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VAX2 from Human, Mouse, Rat. This VAX2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAX2 protein

VAX2 Polyclonal Antibody

ES10465-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VAX2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

VAX2 Polyclonal Antibody

ES10465-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VAX2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

VAX2 antibody

10R-1276 50 ug
EUR 242
Description: Mouse monoclonal VAX2 antibody

VAX2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VAX2. Recognizes VAX2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

Vax2/ Rat Vax2 ELISA Kit

ELI-22472r 96 Tests
EUR 886

Anti-VAX2 antibody

STJ191623 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VAX2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA18091 50 ul
EUR 363
Description: Mouse polyclonal to VAX2

VAX2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VAX2. Recognizes VAX2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VAX2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VAX2. Recognizes VAX2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VAX2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VAX2. Recognizes VAX2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

VAX2 cloning plasmid

CSB-CL025807HU-10ug 10ug
EUR 355
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 873
  • Sequence: atgggcgatgggggcgccgagcgcgaccggggccccgcgcgccgggcggagtctggtggcggcggtgggcgctgcggagaccgcagcggagcgggggacttgcgagctgatggcggtggccacagcccaacggaggtggccgggacctcagcctccagtcccgcaggctccaggga
  • Show more
Description: A cloning plasmid for the VAX2 gene.

Recombinant human VAX2

P2116 100ug Ask for price
  • Uniprot ID: Q9UIW0
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human VAX2

Mouse VAX2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat VAX2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human VAX2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VAX2 Recombinant Protein (Rat)

RP236303 100 ug Ask for price

VAX2 Recombinant Protein (Human)

RP034273 100 ug Ask for price

VAX2 Recombinant Protein (Mouse)

RP183689 100 ug Ask for price

Ventral Anterior Homeobox 2 (VAX2) Antibody

abx031082-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ventral Anterior Homeobox 2 (VAX2) Antibody

abx031082-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Vax2 ORF Vector (Mouse) (pORF)

ORF061231 1.0 ug DNA
EUR 506

Vax2 ORF Vector (Rat) (pORF)

ORF078769 1.0 ug DNA
EUR 506

VAX2 ORF Vector (Human) (pORF)

ORF011425 1.0 ug DNA
EUR 95

Vax2 sgRNA CRISPR Lentivector set (Rat)

K7120701 3 x 1.0 ug
EUR 339

VAX2 sgRNA CRISPR Lentivector set (Human)

K2606701 3 x 1.0 ug
EUR 339

Vax2 sgRNA CRISPR Lentivector set (Mouse)

K4341201 3 x 1.0 ug
EUR 339

Vax2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7120702 1.0 ug DNA
EUR 154

Vax2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7120703 1.0 ug DNA
EUR 154

Vax2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7120704 1.0 ug DNA
EUR 154

VAX2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2606702 1.0 ug DNA
EUR 154

VAX2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2606703 1.0 ug DNA
EUR 154

VAX2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2606704 1.0 ug DNA
EUR 154

Vax2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4341202 1.0 ug DNA
EUR 154

Vax2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4341203 1.0 ug DNA
EUR 154

Vax2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4341204 1.0 ug DNA
EUR 154

VAX2 Protein Vector (Mouse) (pPB-C-His)

PV244922 500 ng
EUR 603

VAX2 Protein Vector (Mouse) (pPB-N-His)

PV244923 500 ng
EUR 603

VAX2 Protein Vector (Mouse) (pPM-C-HA)

PV244924 500 ng
EUR 603

VAX2 Protein Vector (Mouse) (pPM-C-His)

PV244925 500 ng
EUR 603

VAX2 Protein Vector (Rat) (pPB-C-His)

PV315074 500 ng
EUR 603

VAX2 Protein Vector (Rat) (pPB-N-His)

PV315075 500 ng
EUR 603

VAX2 Protein Vector (Rat) (pPM-C-HA)

PV315076 500 ng
EUR 603

VAX2 Protein Vector (Rat) (pPM-C-His)

PV315077 500 ng
EUR 603

VAX2 Protein Vector (Human) (pPB-C-His)

PV045697 500 ng
EUR 329

VAX2 Protein Vector (Human) (pPB-N-His)

PV045698 500 ng
EUR 329

VAX2 Protein Vector (Human) (pPM-C-HA)

PV045699 500 ng
EUR 329

VAX2 Protein Vector (Human) (pPM-C-His)

PV045700 500 ng
EUR 329

Vax2 3'UTR Luciferase Stable Cell Line

TU121740 1.0 ml Ask for price

VAX2 3'UTR GFP Stable Cell Line

TU078064 1.0 ml
EUR 1394

Vax2 3'UTR GFP Stable Cell Line

TU171740 1.0 ml Ask for price

Vax2 3'UTR Luciferase Stable Cell Line

TU223013 1.0 ml Ask for price

VAX2 3'UTR Luciferase Stable Cell Line

TU028064 1.0 ml
EUR 1394

Vax2 3'UTR GFP Stable Cell Line

TU273013 1.0 ml Ask for price

Mouse Ventral anterior homeobox 2, Vax2 ELISA KIT

ELI-51177m 96 Tests
EUR 865

Human Ventral anterior homeobox 2, VAX2 ELISA KIT

ELI-39846h 96 Tests
EUR 824

VAX2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV667477 1.0 ug DNA
EUR 514

VAX2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV667481 1.0 ug DNA
EUR 514

VAX2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV667482 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

VAX2 Rabbit Polyclonal Antibody