WWTR1 Rabbit Polyclonal Antibody
WWTR1 Polyclonal Antibody |
ABP60933-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human WWTR1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of WWTR1 from Human, Mouse. This WWTR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WWTR1 protein |
WWTR1 Polyclonal Antibody |
ABP60933-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human WWTR1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of WWTR1 from Human, Mouse. This WWTR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WWTR1 protein |
WWTR1 Antibody |
44779-100ul |
SAB |
100ul |
EUR 252 |
WWTR1 Antibody |
44779-50ul |
SAB |
50ul |
EUR 187 |
WWTR1 Antibody |
47239-100ul |
SAB |
100ul |
EUR 252 |
WWTR1 antibody |
10R-6288 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal WWTR1 antibody |
WWTR1 antibody |
10R-7240 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal WWTR1 antibody |
WWTR1 Antibody |
DF2465 |
Affbiotech |
200ul |
EUR 304 |
Description: WWTR1 antibody detects endogenous levels of total WWTR1. |
WWTR1 Antibody |
CSB-PA563551- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
Description: A polyclonal antibody against WWTR1. Recognizes WWTR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
WWTR1 Antibody |
CSB-PA563551-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
Description: A polyclonal antibody against WWTR1. Recognizes WWTR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
Polyclonal WWTR1 Antibody (C-term) |
AMM08526G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WWTR1 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal WWTR1 Antibody (C-term) |
AMM08527G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WWTR1 (C-term). This antibody is tested and proven to work in the following applications: |
Phospho-WWTR1-S89 Rabbit pAb |
AP0919-100ul |
Abclonal |
100 ul |
EUR 384 |
Phospho-WWTR1-S89 Rabbit pAb |
AP0919-200ul |
Abclonal |
200 ul |
EUR 554 |
Phospho-WWTR1-S89 Rabbit pAb |
AP0919-20ul |
Abclonal |
20 ul |
EUR 183 |
Phospho-WWTR1-S89 Rabbit pAb |
AP0919-50ul |
Abclonal |
50 ul |
EUR 265 |
Polyclonal WWTR1 antibody - N-terminal region |
AMM08528G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WWTR1 - N-terminal region. This antibody is tested and proven to work in the following applications: |
WWTR1 Conjugated Antibody |
C44779 |
SAB |
100ul |
EUR 397 |
WWTR1 Conjugated Antibody |
C47239 |
SAB |
100ul |
EUR 397 |
Anti-WWTR1 antibody |
STJ191805 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to WWTR1 |
WWTR1 siRNA |
20-abx939951 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WWTR1 siRNA |
20-abx939952 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WWTR1 Blocking Peptide |
DF2465-BP |
Affbiotech |
1mg |
EUR 195 |
WWTR1 cloning plasmid |
CSB-CL887938HU-10ug |
Cusabio |
10ug |
EUR 447 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1203
- Sequence: atgaatccggcctcggcgccccctccgctcccgccgcctgggcagcaagtgatccacgtcacgcaggacctagacacagacctcgaagccctcttcaactctgtcatgaatccgaagcctagctcgtggcggaagaagatcctgccggagtctttctttaaggagcctgattcgg
- Show more
|
Description: A cloning plasmid for the WWTR1 gene. |
Mouse WWTR1 shRNA Plasmid |
20-abx979326 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human WWTR1 shRNA Plasmid |
20-abx958601 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
WWTR1 protein (His tag) |
80R-3613 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant WWTR1 protein (His tag) |
WWTR1 Rabbit Polyclonal Antibody