WWTR1 Rabbit Polyclonal Antibody

WWTR1 Rabbit Polyclonal Antibody

WWTR1 Polyclonal Antibody

ABP60933-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human WWTR1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of WWTR1 from Human, Mouse. This WWTR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WWTR1 protein

WWTR1 Polyclonal Antibody

ABP60933-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human WWTR1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of WWTR1 from Human, Mouse. This WWTR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WWTR1 protein

WWTR1 Antibody

ABD13350 100 ug
EUR 438

WWTR1 Antibody

ABD2465 100 ug
EUR 438

WWTR1 Antibody

44779-100ul 100ul
EUR 252

WWTR1 Antibody

44779-50ul 50ul
EUR 187

WWTR1 Antibody

47239-100ul 100ul
EUR 252

WWTR1 antibody

10R-6288 100 ul
EUR 691
Description: Mouse monoclonal WWTR1 antibody

WWTR1 antibody

10R-7240 100 ul
EUR 691
Description: Mouse monoclonal WWTR1 antibody

WWTR1 Antibody

DF2465 200ul
EUR 304
Description: WWTR1 antibody detects endogenous levels of total WWTR1.

WWTR1 Antibody

CSB-PA563551-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against WWTR1. Recognizes WWTR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

WWTR1 Antibody

CSB-PA563551-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against WWTR1. Recognizes WWTR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Polyclonal WWTR1 Antibody (C-term)

AMM08526G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WWTR1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal WWTR1 Antibody (C-term)

AMM08527G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WWTR1 (C-term). This antibody is tested and proven to work in the following applications:

Phospho-WWTR1-S89 Rabbit pAb

AP0919-100ul 100 ul
EUR 384

Phospho-WWTR1-S89 Rabbit pAb

AP0919-200ul 200 ul
EUR 554

Phospho-WWTR1-S89 Rabbit pAb

AP0919-20ul 20 ul
EUR 183

Phospho-WWTR1-S89 Rabbit pAb

AP0919-50ul 50 ul
EUR 265

Polyclonal WWTR1 antibody - N-terminal region

AMM08528G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WWTR1 - N-terminal region. This antibody is tested and proven to work in the following applications:

WWTR1 Conjugated Antibody

C44779 100ul
EUR 397

WWTR1 Conjugated Antibody

C47239 100ul
EUR 397

Anti-WWTR1 antibody

STJ110501 100 µl
EUR 277

Anti-WWTR1 antibody

STJ118265 100 µl
EUR 277

Anti-WWTR1 antibody

STJ191805 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to WWTR1

WWTR1 siRNA

20-abx939951
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WWTR1 siRNA

20-abx939952
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WWTR1 Blocking Peptide

DF2465-BP 1mg
EUR 195

WWTR1 cloning plasmid

CSB-CL887938HU-10ug 10ug
EUR 447
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1203
  • Sequence: atgaatccggcctcggcgccccctccgctcccgccgcctgggcagcaagtgatccacgtcacgcaggacctagacacagacctcgaagccctcttcaactctgtcatgaatccgaagcctagctcgtggcggaagaagatcctgccggagtctttctttaaggagcctgattcgg
  • Show more
Description: A cloning plasmid for the WWTR1 gene.

Anti-Phospho-WWTR1-S89 antibody

STJ11101053 100 µl
EUR 393

Mouse WWTR1 shRNA Plasmid

20-abx979326
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human WWTR1 ELISA KIT

ELI-17467h 96 Tests
EUR 824

Mouse Wwtr1 ELISA KIT

ELI-51531m 96 Tests
EUR 865

Human WWTR1 shRNA Plasmid

20-abx958601
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

WWTR1 protein (His tag)

80R-3613 100 ug
EUR 327
Description: Purified recombinant WWTR1 protein (His tag)

WWTR1 Rabbit Polyclonal Antibody