WWTR1 Rabbit Polyclonal Antibody

WWTR1 Rabbit Polyclonal Antibody

WWTR1 Polyclonal Antibody

ES10647-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WWTR1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

WWTR1 Polyclonal Antibody

ES10647-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WWTR1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

WWTR1 Antibody

47239-100ul 100ul
EUR 252

WWTR1 antibody

10R-6288 100 ul
EUR 691
Description: Mouse monoclonal WWTR1 antibody

WWTR1 antibody

10R-7240 100 ul
EUR 691
Description: Mouse monoclonal WWTR1 antibody

WWTR1 Antibody

44779-100ul 100ul
EUR 252

WWTR1 Antibody

44779-50ul 50ul
EUR 187

WWTR1 Antibody

DF2465 200ul
EUR 304
Description: WWTR1 antibody detects endogenous levels of total WWTR1.

WWTR1 Antibody

CSB-PA563551-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against WWTR1. Recognizes WWTR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

WWTR1 Antibody

CSB-PA563551-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against WWTR1. Recognizes WWTR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

WWTR1 Antibody

ABD13350 100 ug
EUR 438

WWTR1 Antibody

ABD2465 100 ug
EUR 438

Polyclonal WWTR1 Antibody (C-term)

AMM08526G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WWTR1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal WWTR1 Antibody (C-term)

AMM08527G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WWTR1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal WWTR1 antibody - N-terminal region

AMM08528G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WWTR1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Phospho-WWTR1-S89 Rabbit pAb

AP0919-100ul 100 ul
EUR 384

Phospho-WWTR1-S89 Rabbit pAb

AP0919-200ul 200 ul
EUR 554

Phospho-WWTR1-S89 Rabbit pAb

AP0919-20ul 20 ul
EUR 183

Phospho-WWTR1-S89 Rabbit pAb

AP0919-50ul 50 ul
EUR 265

WWTR1 Conjugated Antibody

C44779 100ul
EUR 397

WWTR1 Conjugated Antibody

C47239 100ul
EUR 397

Anti-WWTR1 antibody

STJ110501 100 µl
EUR 277

Anti-WWTR1 antibody

STJ118265 100 µl
EUR 277

Anti-WWTR1 antibody

STJ191805 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to WWTR1

WWTR1 siRNA

20-abx939951
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WWTR1 siRNA

20-abx939952
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WWTR1 Blocking Peptide

DF2465-BP 1mg
EUR 195

WWTR1 cloning plasmid

CSB-CL887938HU-10ug 10ug
EUR 447
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1203
  • Sequence: atgaatccggcctcggcgccccctccgctcccgccgcctgggcagcaagtgatccacgtcacgcaggacctagacacagacctcgaagccctcttcaactctgtcatgaatccgaagcctagctcgtggcggaagaagatcctgccggagtctttctttaaggagcctgattcgg
  • Show more
Description: A cloning plasmid for the WWTR1 gene.

Anti-Phospho-WWTR1-S89 antibody

STJ11101053 100 µl
EUR 393

WWTR1 protein (His tag)

80R-3613 100 ug
EUR 327
Description: Purified recombinant WWTR1 protein (His tag)

Human WWTR1 ELISA KIT

ELI-17467h 96 Tests
EUR 824

Mouse Wwtr1 ELISA KIT

ELI-51531m 96 Tests
EUR 865

Human WWTR1 shRNA Plasmid

20-abx958601
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse WWTR1 shRNA Plasmid

20-abx979326
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

WWTR1 Rabbit Polyclonal Antibody