ZHX3 Rabbit Polyclonal Antibody

ZHX3 Rabbit Polyclonal Antibody

ZHX3 Polyclonal Antibody

ABP60968-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ZHX3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ZHX3 from Human, Mouse, Rat. This ZHX3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZHX3 protein

Zhx3 antibody

70R-8211 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Zhx3 antibody

ZHX3 antibody

70R-9570 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZHX3 antibody

ZHX3 antibody

70R-9571 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZHX3 antibody

ZHX3   Antibody

47486-100ul 100ul
EUR 252

Zhx3/ Rat Zhx3 ELISA Kit

ELI-22600r 96 Tests
EUR 886

ZHX3   Conjugated Antibody

C47486 100ul
EUR 397

Anti-ZHX3 antibody

STJ191650 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ZHX3

ZHX3 siRNA

20-abx906181
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZHX3 siRNA

20-abx940480
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZHX3 siRNA

20-abx940481
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ZHX3

YF-PA17723 50 ug
EUR 363
Description: Mouse polyclonal to ZHX3

Zhx3 Blocking Peptide

33R-6698 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Zhx3 antibody, catalog no. 70R-8211

ZHX3 Blocking Peptide

33R-2062 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZHX3 antibody, catalog no. 70R-9571

ZHX3 Blocking Peptide

33R-2763 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZHX3 antibody, catalog no. 70R-9570

ZHX3 cloning plasmid

CSB-CL872496HU-10ug 10ug
EUR 924
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2910
  • Sequence: atggccagcaagaggaaatccaccacaccatgcatgatcccagtgaagactgtggtgttgcaagatgccagcatggaggcccagcccgctgagaccttgcctgaaggaccccagcaggatctgcccccagaagcatctgctgccagcagtgaggcagcacagaaccccagcagta
  • Show more
Description: A cloning plasmid for the ZHX3 gene.

Anti-ZHX3 (1D9)

YF-MA17797 100 ug
EUR 363
Description: Mouse monoclonal to ZHX3

Rat ZHX3 shRNA Plasmid

20-abx989683
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ZHX3 shRNA Plasmid

20-abx983454
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ZHX3 shRNA Plasmid

20-abx957961
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Zhx3 ORF Vector (Rat) (pORF)

ORF079561 1.0 ug DNA
EUR 506

ZHX3 ORF Vector (Human) (pORF)

ORF011815 1.0 ug DNA
EUR 95

Zhx3 ORF Vector (Mouse) (pORF)

ORF062687 1.0 ug DNA
EUR 506

ZHX3 sgRNA CRISPR Lentivector set (Human)

K2676901 3 x 1.0 ug
EUR 339

Zhx3 sgRNA CRISPR Lentivector set (Mouse)

K4257401 3 x 1.0 ug
EUR 339

Zhx3 sgRNA CRISPR Lentivector set (Rat)

K7490101 3 x 1.0 ug
EUR 339

ZHX3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2676902 1.0 ug DNA
EUR 154

ZHX3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2676903 1.0 ug DNA
EUR 154

ZHX3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2676904 1.0 ug DNA
EUR 154

Zhx3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4257402 1.0 ug DNA
EUR 154

Zhx3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4257403 1.0 ug DNA
EUR 154

Zhx3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4257404 1.0 ug DNA
EUR 154

Zhx3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7490102 1.0 ug DNA
EUR 154

Zhx3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7490103 1.0 ug DNA
EUR 154

Zhx3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7490104 1.0 ug DNA
EUR 154

ZHX3 Protein Vector (Human) (pPB-C-His)

PV047257 500 ng
EUR 329

ZHX3 Protein Vector (Human) (pPB-N-His)

PV047258 500 ng
EUR 329

ZHX3 Protein Vector (Human) (pPM-C-HA)

PV047259 500 ng
EUR 329

ZHX3 Protein Vector (Human) (pPM-C-His)

PV047260 500 ng
EUR 329

ZHX3 Protein Vector (Rat) (pPB-C-His)

PV318242 500 ng
EUR 1166

ZHX3 Protein Vector (Rat) (pPB-N-His)

PV318243 500 ng
EUR 1166

ZHX3 Protein Vector (Rat) (pPM-C-HA)

PV318244 500 ng
EUR 1166

ZHX3 Protein Vector (Rat) (pPM-C-His)

PV318245 500 ng
EUR 1166

ZHX3 Protein Vector (Mouse) (pPB-C-His)

PV250746 500 ng
EUR 1065

ZHX3 Protein Vector (Mouse) (pPB-N-His)

PV250747 500 ng
EUR 1065

ZHX3 Protein Vector (Mouse) (pPM-C-HA)

PV250748 500 ng
EUR 1065

ZHX3 Protein Vector (Mouse) (pPM-C-His)

PV250749 500 ng
EUR 1065

Zhx3 3'UTR GFP Stable Cell Line

TU172968 1.0 ml Ask for price

Zhx3 3'UTR Luciferase Stable Cell Line

TU122968 1.0 ml Ask for price

ZHX3 3'UTR GFP Stable Cell Line

TU078881 1.0 ml
EUR 4617

ZHX3 3'UTR Luciferase Stable Cell Line

TU028881 1.0 ml
EUR 4617

Zhx3 3'UTR Luciferase Stable Cell Line

TU223864 1.0 ml Ask for price

Zhx3 3'UTR GFP Stable Cell Line

TU273864 1.0 ml Ask for price

ZHX3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV667519 1.0 ug DNA
EUR 1355

ZHX3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV667523 1.0 ug DNA
EUR 1355

ZHX3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV667524 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ZHX3 Rabbit Polyclonal Antibody