ZHX3 Rabbit Polyclonal Antibody
ZHX3 Polyclonal Antibody |
ABP60968-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ZHX3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ZHX3 from Human, Mouse, Rat. This ZHX3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZHX3 protein |
Zhx3 antibody |
70R-8211 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Zhx3 antibody |
ZHX3 antibody |
70R-9570 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal ZHX3 antibody |
ZHX3 antibody |
70R-9571 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal ZHX3 antibody |
ZHX3 Antibody |
47486-100ul |
SAB |
100ul |
EUR 252 |
ZHX3 Conjugated Antibody |
C47486 |
SAB |
100ul |
EUR 397 |
Anti-ZHX3 antibody |
STJ191650 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ZHX3 |
ZHX3 siRNA |
20-abx906181 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ZHX3 siRNA |
20-abx940480 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ZHX3 siRNA |
20-abx940481 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ZHX3 |
YF-PA17723 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to ZHX3 |
Zhx3 Blocking Peptide |
33R-6698 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Zhx3 antibody, catalog no. 70R-8211 |
ZHX3 Blocking Peptide |
33R-2062 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZHX3 antibody, catalog no. 70R-9571 |
ZHX3 Blocking Peptide |
33R-2763 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZHX3 antibody, catalog no. 70R-9570 |
ZHX3 cloning plasmid |
CSB-CL872496HU-10ug |
Cusabio |
10ug |
EUR 924 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2910
- Sequence: atggccagcaagaggaaatccaccacaccatgcatgatcccagtgaagactgtggtgttgcaagatgccagcatggaggcccagcccgctgagaccttgcctgaaggaccccagcaggatctgcccccagaagcatctgctgccagcagtgaggcagcacagaaccccagcagta
- Show more
|
Description: A cloning plasmid for the ZHX3 gene. |
Anti-ZHX3 (1D9) |
YF-MA17797 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ZHX3 |
Rat ZHX3 shRNA Plasmid |
20-abx989683 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ZHX3 shRNA Plasmid |
20-abx983454 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ZHX3 shRNA Plasmid |
20-abx957961 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Zhx3 ORF Vector (Rat) (pORF) |
ORF079561 |
ABM |
1.0 ug DNA |
EUR 506 |
ZHX3 ORF Vector (Human) (pORF) |
ORF011815 |
ABM |
1.0 ug DNA |
EUR 95 |
Zhx3 ORF Vector (Mouse) (pORF) |
ORF062687 |
ABM |
1.0 ug DNA |
EUR 506 |
ZHX3 sgRNA CRISPR Lentivector set (Human) |
K2676901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Zhx3 sgRNA CRISPR Lentivector set (Mouse) |
K4257401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Zhx3 sgRNA CRISPR Lentivector set (Rat) |
K7490101 |
ABM |
3 x 1.0 ug |
EUR 339 |
ZHX3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2676902 |
ABM |
1.0 ug DNA |
EUR 154 |
ZHX3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2676903 |
ABM |
1.0 ug DNA |
EUR 154 |
ZHX3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2676904 |
ABM |
1.0 ug DNA |
EUR 154 |
Zhx3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4257402 |
ABM |
1.0 ug DNA |
EUR 154 |
Zhx3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4257403 |
ABM |
1.0 ug DNA |
EUR 154 |
Zhx3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4257404 |
ABM |
1.0 ug DNA |
EUR 154 |
Zhx3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7490102 |
ABM |
1.0 ug DNA |
EUR 154 |
Zhx3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7490103 |
ABM |
1.0 ug DNA |
EUR 154 |
Zhx3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7490104 |
ABM |
1.0 ug DNA |
EUR 154 |
ZHX3 Protein Vector (Human) (pPB-C-His) |
PV047257 |
ABM |
500 ng |
EUR 329 |
ZHX3 Protein Vector (Human) (pPB-N-His) |
PV047258 |
ABM |
500 ng |
EUR 329 |
ZHX3 Protein Vector (Human) (pPM-C-HA) |
PV047259 |
ABM |
500 ng |
EUR 329 |
ZHX3 Protein Vector (Human) (pPM-C-His) |
PV047260 |
ABM |
500 ng |
EUR 329 |
ZHX3 Protein Vector (Rat) (pPB-C-His) |
PV318242 |
ABM |
500 ng |
EUR 1166 |
ZHX3 Protein Vector (Rat) (pPB-N-His) |
PV318243 |
ABM |
500 ng |
EUR 1166 |
ZHX3 Protein Vector (Rat) (pPM-C-HA) |
PV318244 |
ABM |
500 ng |
EUR 1166 |
ZHX3 Protein Vector (Rat) (pPM-C-His) |
PV318245 |
ABM |
500 ng |
EUR 1166 |
ZHX3 Protein Vector (Mouse) (pPB-C-His) |
PV250746 |
ABM |
500 ng |
EUR 1065 |
ZHX3 Protein Vector (Mouse) (pPB-N-His) |
PV250747 |
ABM |
500 ng |
EUR 1065 |
ZHX3 Protein Vector (Mouse) (pPM-C-HA) |
PV250748 |
ABM |
500 ng |
EUR 1065 |
ZHX3 Protein Vector (Mouse) (pPM-C-His) |
PV250749 |
ABM |
500 ng |
EUR 1065 |
Zhx3 3'UTR GFP Stable Cell Line |
TU172968 |
ABM |
1.0 ml |
Ask for price |
Zhx3 3'UTR Luciferase Stable Cell Line |
TU122968 |
ABM |
1.0 ml |
Ask for price |
ZHX3 3'UTR GFP Stable Cell Line |
TU078881 |
ABM |
1.0 ml |
EUR 4617 |
ZHX3 3'UTR Luciferase Stable Cell Line |
TU028881 |
ABM |
1.0 ml |
EUR 4617 |
Zhx3 3'UTR Luciferase Stable Cell Line |
TU223864 |
ABM |
1.0 ml |
Ask for price |
Zhx3 3'UTR GFP Stable Cell Line |
TU273864 |
ABM |
1.0 ml |
Ask for price |
ZHX3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV667519 |
ABM |
1.0 ug DNA |
EUR 1355 |
ZHX3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV667523 |
ABM |
1.0 ug DNA |
EUR 1355 |
ZHX3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV667524 |
ABM |
1.0 ug DNA |
EUR 1355 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ZHX3 Rabbit Polyclonal Antibody