Da vinci european bio bank

APOC2 Rabbit Polyclonal Antibody

Human Apolipoprotein C2 (APOC2) ELISA Kit
DLR-APOC2-Hu-48T	DL Develop	48T	EUR 498
Should the Human Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein C2 (APOC2) in samples from serum, plasma or other biological fluids.

Human Apolipoprotein C2 (APOC2) ELISA Kit
DLR-APOC2-Hu-96T	DL Develop	96T	EUR 647
Should the Human Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein C2 (APOC2) in samples from serum, plasma or other biological fluids.

Mouse Apolipoprotein C2 (APOC2) ELISA Kit
DLR-APOC2-Mu-48T	DL Develop	48T	EUR 508
Should the Mouse Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Apolipoprotein C2 (APOC2) ELISA Kit
DLR-APOC2-Mu-96T	DL Develop	96T	EUR 661
Should the Mouse Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Apolipoprotein C2 (APOC2) ELISA Kit
DLR-APOC2-Ra-48T	DL Develop	48T	EUR 528
Should the Rat Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Apolipoprotein C2 (APOC2) ELISA Kit
DLR-APOC2-Ra-96T	DL Develop	96T	EUR 690
Should the Rat Apolipoprotein C2 (APOC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein C2 (APOC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Apolipoprotein C2 (APOC2) ELISA Kit
RD-APOC2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Apolipoprotein C2 (APOC2) ELISA Kit
RD-APOC2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Apolipoprotein C2 (APOC2) ELISA Kit
RD-APOC2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Apolipoprotein C2 (APOC2) ELISA Kit
RD-APOC2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Apolipoprotein C2 (APOC2) ELISA Kit
RD-APOC2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Apolipoprotein C2 (APOC2) ELISA Kit
RD-APOC2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Apolipoprotein C2 (APOC2) ELISA Kit
RDR-APOC2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Apolipoprotein C2 (APOC2) ELISA Kit
RDR-APOC2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Mouse Apolipoprotein C2 (APOC2) ELISA Kit
RDR-APOC2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Apolipoprotein C2 (APOC2) ELISA Kit
RDR-APOC2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Rat Apolipoprotein C2 (APOC2) ELISA Kit
RDR-APOC2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat Apolipoprotein C2 (APOC2) ELISA Kit
RDR-APOC2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776

APOC2 Rabbit pAb
A1772-100ul	Abclonal	100 ul	EUR 308

APOC2 Rabbit pAb
A1772-200ul	Abclonal	200 ul	EUR 459

APOC2 Rabbit pAb
A1772-20ul	Abclonal	20 ul	EUR 183

APOC2 Rabbit pAb
A1772-50ul	Abclonal	50 ul	EUR 223

Rabbit APOC2 ELISA Kit
ERTA0522	Abclonal	96Tests	EUR 521

APOC2 Antibody
ABD6607	Lifescience Market	100 ug	EUR 438

APOC2 antibody
38294-100ul	SAB	100ul	EUR 252

ApoC2 antibody
20C-CR9014GP	Fitzgerald	1 mg	EUR 165
Description: Goat polyclonal ApoC2 antibody (IgG fraction)

APOC2 Antibody
DF6607	Affbiotech	200ul	EUR 304
Description: APOC2 Antibody detects endogenous levels of total APOC2.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse)
4-PAB996Eq01	Cloud-Clone	EUR 271.00 EUR 2892.00 EUR 712.00 EUR 344.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Thr23~Ser101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2)

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse)
4-PAB996Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Ile13~Glu97) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2)

APOC2 Conjugated Antibody
C38294	SAB	100ul	EUR 397

ApoC2 Antibody (Center)
6718-100	Biovision		EUR 316

Anti-APOC2 antibody
STJ119761	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene.

Anti-APOC2 antibody
STJ192002	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to APOC2

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), APC
4-PAB996Eq01-APC	Cloud-Clone	EUR 382.00 EUR 3797.00 EUR 1043.00 EUR 492.00 EUR 234.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Thr23~Ser101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with APC.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), Biotinylated
4-PAB996Eq01-Biotin	Cloud-Clone	EUR 338.00 EUR 2842.00 EUR 823.00 EUR 419.00 EUR 230.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Thr23~Ser101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with Biotin.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), Cy3
4-PAB996Eq01-Cy3	Cloud-Clone	EUR 468.00 EUR 5021.00 EUR 1349.00 EUR 614.00 EUR 271.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Thr23~Ser101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with Cy3.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), FITC
4-PAB996Eq01-FITC	Cloud-Clone	EUR 325.00 EUR 3057.00 EUR 854.00 EUR 413.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Thr23~Ser101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with FITC.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), HRP
4-PAB996Eq01-HRP	Cloud-Clone	EUR 348.00 EUR 3307.00 EUR 920.00 EUR 443.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Thr23~Ser101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with HRP.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), PE
4-PAB996Eq01-PE	Cloud-Clone	EUR 325.00 EUR 3057.00 EUR 854.00 EUR 413.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Thr23~Ser101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with PE.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig)
4-PAB996Gu01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Asp32~Gln100) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2)

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), APC
4-PAB996Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Ile13~Glu97) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with APC.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), Biotinylated
4-PAB996Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Ile13~Glu97) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with Biotin.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), Cy3
4-PAB996Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Ile13~Glu97) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with Cy3.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), FITC
4-PAB996Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Ile13~Glu97) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with FITC.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), HRP
4-PAB996Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Ile13~Glu97) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with HRP.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), PE
4-PAB996Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Ile13~Glu97) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with PE.

Rabbit Apolipoprotein C2 (APOC2) ELISA Kit
abx363339-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

APOC2 siRNA
20-abx907836	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

APOC2 siRNA
20-abx907837	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ApoC2 protein
30R-2678	Fitzgerald	50 ug	EUR 302
Description: Purified native Human ApoC2 protein

ApoC2 protein
30-1051	Fitzgerald	100 ug	EUR 1426
Description: Purified native Human ApoC2 protein

Apolipoprotein C2 (APOC2) Antibody
20-abx130650	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Apolipoprotein C2 (APOC2) Antibody
20-abx171276	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Apolipoprotein C2 (APOC2) Antibody
20-abx171277	Abbexa	EUR 871.00 EUR 453.00	1 mg 200 ug
Please enquire.

Apolipoprotein C2 (APOC2) Antibody
20-abx101715	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Apolipoprotein C2 (APOC2) Antibody
20-abx104940	Abbexa	EUR 467.00 EUR 133.00 EUR 1386.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Apolipoprotein C2 (APOC2) Antibody
20-abx009580	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Apolipoprotein C2 (APOC2) Antibody
20-abx175434	Abbexa	EUR 1149.00 EUR 565.00	1 mg 200 ug
Please enquire.

Apolipoprotein C2 (APOC2) Antibody
20-abx175435	Abbexa	EUR 1247.00 EUR 592.00	1 mg 200 ug
Please enquire.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Horse), APC-Cy7
4-PAB996Eq01-APC-Cy7	Cloud-Clone	EUR 644.00 EUR 7474.00 EUR 1966.00 EUR 864.00 EUR 349.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Thr23~Ser101) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Horse Apolipoprotein C2 (APOC2). This antibody is labeled with APC-Cy7.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), APC
4-PAB996Gu01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Asp32~Gln100) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with APC.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), Biotinylated
4-PAB996Gu01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Asp32~Gln100) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with Biotin.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), Cy3
4-PAB996Gu01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Asp32~Gln100) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with Cy3.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), FITC
4-PAB996Gu01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Asp32~Gln100) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with FITC.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), HRP
4-PAB996Gu01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Asp32~Gln100) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with HRP.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), PE
4-PAB996Gu01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Asp32~Gln100) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with PE.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB996Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Ile13~Glu97) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Apolipoprotein C2 (APOC2). This antibody is labeled with APC-Cy7.

APOC2 Blocking Peptide
DF6607-BP	Affbiotech	1mg	EUR 195

APOC2 cloning plasmid
CSB-CL001932HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 306 Sequence: atgggcacacgactcctcccagctctgtttcttgtcctcctggtattgggatttgaggtccaggggacccaacagccccagcaagatgagatgcctagcccgaccctcctcacccaggtgaaggaatctctctccagttactgggagtcagcaaagacagccgcccagaacctgta Show more
Description: A cloning plasmid for the APOC2 gene.

APOC2 cloning plasmid
CSB-CL001932HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 219 Sequence: atgggcacacgactcctcccagctctgtttcttgtcctcctggtattgggatttgaggtccaggggacccaacagccccagcaagatgagatgcctagcccgaccttcctcacccaggtgaaggaatctctctccagttactgggagtcagcaaagacagccgcccagaacctgta Show more
Description: A cloning plasmid for the APOC2 gene.

Apolipoprotein C2 (APOC2) Antibody (Biotin)
20-abx272948	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Apolipoprotein C2 (APOC2) Polyclonal Antibody (Guinea pig), APC-Cy7
4-PAB996Gu01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: APOC2 (Asp32~Gln100) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Apolipoprotein C2 (APOC2). This antibody is labeled with APC-Cy7.

Human APOC2 ELISA Kit
EHA0522	Abclonal	96Tests	EUR 521

Human APOC2 ELISA Kit
ELA-E1996h	Lifescience Market	96 Tests	EUR 824

Goat APOC2 ELISA Kit
EGTA0522	Abclonal	96Tests	EUR 521

Canine APOC2 ELISA Kit
ECA0522	Abclonal	96Tests	EUR 521

Chicken APOC2 ELISA Kit
ECKA0522	Abclonal	96Tests	EUR 521

Bovine APOC2 ELISA Kit
EBA0522	Abclonal	96Tests	EUR 521

Anserini APOC2 ELISA Kit
EAA0522	Abclonal	96Tests	EUR 521

APOC2 ELISA KIT|Human
EF000399	Lifescience Market	96 Tests	EUR 689

Rat APOC2 ELISA Kit
ERA0522	Abclonal	96Tests	EUR 521

Sheep APOC2 ELISA Kit
ESA0522	Abclonal	96Tests	EUR 521

Porcine APOC2 ELISA Kit
EPA0522	Abclonal	96Tests	EUR 521

Mouse APOC2 ELISA Kit
EMA0522	Abclonal	96Tests	EUR 521

Monkey APOC2 ELISA Kit
EMKA0522	Abclonal	96Tests	EUR 521

Human APOC2 shRNA Plasmid
20-abx950242	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse APOC2 shRNA Plasmid
20-abx969195	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

APOC2 Recombinant Protein (Human)
RP001582	ABM	100 ug	Ask for price

APOC2 Recombinant Protein (Human)
RP001585	ABM	100 ug	Ask for price

Recombinant Apolipoprotein C2 (APOC2)
4-RPB996Eq01	Cloud-Clone	EUR 548.00 EUR 250.00 EUR 1780.00 EUR 660.00 EUR 1220.00 EUR 430.00 EUR 4300.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: F7A1W7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 12.5kDa Isoelectric Point: Inquire
Description: Recombinant Horse Apolipoprotein C2 expressed in: E.coli

Recombinant Apolipoprotein C2 (APOC2)
4-RPB996Gu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P27916 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 37.5kDa Isoelectric Point: Inquire
Description: Recombinant Guinea pig Apolipoprotein C2 expressed in: E.coli

Recombinant Apolipoprotein C2 (APOC2)
4-RPB996Mu01	Cloud-Clone	EUR 449.44 EUR 223.00 EUR 1410.40 EUR 536.80 EUR 973.60 EUR 364.00 EUR 3376.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q05020 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 39.4kDa Isoelectric Point: 6
Description: Recombinant Mouse Apolipoprotein C2 expressed in: E.coli

APOC2 Recombinant Protein (Rat)
RP190565	ABM	100 ug	Ask for price

APOC2 Recombinant Protein (Mouse)
RP116459	ABM	100 ug	Ask for price

Rat Apolipoprotein C2 (APOC2) Protein
20-abx652550	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Apolipoprotein C2 (APOC2) Protein
20-abx652551	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Guinea Pig APOC2 ELISA Kit
EGA0522	Abclonal	96Tests	EUR 521

ApoC2 receptor ELISA KIT|Human
EF007480	Lifescience Market	96 Tests	EUR 689

Mouse Apolipoprotein C2 (APOC2) Protein
20-abx065420	Abbexa	EUR 634.00 EUR 272.00 EUR 1901.00 EUR 746.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Horse Apolipoprotein C2 (APOC2) Protein
20-abx166394	Abbexa	EUR 759.00 EUR 300.00 EUR 2388.00 EUR 913.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Apolipoprotein C-II (APOC2)
1-CSB-YP001932HU	Cusabio	EUR 586.00 EUR 299.00 EUR 2172.00 EUR 900.00 EUR 1442.00 EUR 382.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 10.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Apolipoprotein C-II(APOC2) expressed in Yeast

APOC2 Rabbit Polyclonal Antibody