BAG2 Rabbit Polyclonal Antibody
BAG2 Polyclonal Antibody |
ABP57884-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human BAG2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of BAG2 from Human, Mouse. This BAG2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BAG2 protein |
BAG2 Polyclonal Antibody |
ABP57884-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human BAG2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of BAG2 from Human, Mouse. This BAG2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BAG2 protein |
BAG2 Polyclonal Antibody |
ABP57884-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human BAG2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of BAG2 from Human, Mouse. This BAG2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BAG2 protein |
BAG2 Rabbit pAb |
A7763-100ul |
Abclonal |
100 ul |
EUR 308 |
BAG2 Rabbit pAb |
A7763-200ul |
Abclonal |
200 ul |
EUR 459 |
BAG2 Rabbit pAb |
A7763-20ul |
Abclonal |
20 ul |
EUR 183 |
BAG2 Rabbit pAb |
A7763-50ul |
Abclonal |
50 ul |
EUR 223 |
BAG2 antibody |
70R-33153 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Rabbit polyclonal BAG2 antibody |
BAG2 Antibody |
43282-100ul |
SAB |
100ul |
EUR 252 |
BAG2 antibody |
70R-1666 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal BAG2 antibody raised against the C terminal of BAG2 |
BAG2 Antibody |
DF7876 |
Affbiotech |
200ul |
EUR 304 |
Description: BAG2 Antibody detects endogenous levels of total BAG2. |
BAG2 Antibody |
DF2650 |
Affbiotech |
200ul |
EUR 304 |
Description: BAG2 antibody detects endogenous levels of total BAG2. |
BAG2 Antibody |
1-CSB-PA002530ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against BAG2. Recognizes BAG2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
Polyclonal Goat Anti-BAG2 Antibody |
AMM04907G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-BAG2 . This antibody is tested and proven to work in the following applications: |
Polyclonal BAG2 Antibody (C-term) |
APR07076G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BAG2 (C-term). This antibody is tested and proven to work in the following applications: |
[KO Validated] BAG2 Rabbit pAb |
A19945-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] BAG2 Rabbit pAb |
A19945-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] BAG2 Rabbit pAb |
A19945-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] BAG2 Rabbit pAb |
A19945-50ul |
Abclonal |
50 ul |
EUR 287 |
BAG2 Conjugated Antibody |
C43282 |
SAB |
100ul |
EUR 397 |
Anti-BAG2 Antibody |
PB9524 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-BAG2 Antibody |
PA2099 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-BAG2 antibody |
STJ110074 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The predicted BAG2 protein contains 211 amino acids. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. |
Anti-BAG2 antibody |
STJ11100821 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The predicted BAG2 protein contains 211 amino acids. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. |
Anti-BAG2 antibody |
STJ191961 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to BAG2 |
BAG2 siRNA |
20-abx908838 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BAG2 siRNA |
20-abx908839 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-BAG2 |
YF-PA16374 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to BAG2 |
anti-BAG2 |
YF-PA16375 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to BAG2 |
anti-BAG2 |
YF-PA25359 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to BAG2 |
BAG2 recombinant monoclonal antibody |
A5493 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human BAG2 for WB,ELISA |
Anti-BAG2 Monoclonal Antibody |
M04933 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal BAG2 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |
BAG2 Blocking Peptide |
33R-9474 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BAG2 antibody, catalog no. 70R-1666 |
BAG2 Blocking Peptide |
DF7876-BP |
Affbiotech |
1mg |
EUR 195 |
BAG2 Blocking Peptide |
DF2650-BP |
Affbiotech |
1mg |
EUR 195 |
BAG2 cloning plasmid |
CSB-CL002530HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 636
- Sequence: ATGGCTCAGGCGAAGATCAACGCTAAAGCCAACGAGGGGCGCTTCTGCCGCTCCTCCTCCATGGCTGACCGCTCCAGCCGCCTGCTGGAGAGCCTGGACCAGCTGGAGCTCAGGGTTGAAGCTTTGAGAGAAGCAGCAACTGCTGTTGAGCAAGAGAAAGAAATCCTTCTGGAAAT
- Show more
|
Description: A cloning plasmid for the BAG2 gene. |
Anti-BAG2 (6E12) |
YF-MA16900 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to BAG2 |
Mouse BAG2 shRNA Plasmid |
20-abx980818 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human BAG2 shRNA Plasmid |
20-abx956337 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
BAG2 protein (His tag) |
80R-1710 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human BAG2 protein |
BAG2 Recombinant Protein (Human) |
RP036901 |
ABM |
100 ug |
Ask for price |
BAG2 Recombinant Protein (Rat) |
RP191822 |
ABM |
100 ug |
Ask for price |
BAG2 Recombinant Protein (Mouse) |
RP118646 |
ABM |
100 ug |
Ask for price |
Bag2 ORF Vector (Mouse) (pORF) |
ORF039550 |
ABM |
1.0 ug DNA |
EUR 506 |
BAG2 ORF Vector (Human) (pORF) |
ORF012301 |
ABM |
1.0 ug DNA |
EUR 354 |
Bag2 ORF Vector (Rat) (pORF) |
ORF063942 |
ABM |
1.0 ug DNA |
EUR 506 |
Monoclonal BAG2 Antibody (monoclonal) (M01), Clone: 6.0E+12 |
APG02182G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human BAG2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 6.0E+12. This antibody is applicable in WB |
BAG Family Molecular Chaperone Regulator 2 (BAG2) Antibody |
20-abx007056 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
BAG Family Molecular Chaperone Regulator 2 (BAG2) Antibody |
abx027768-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
BAG Family Molecular Chaperone Regulator 2 (BAG2) Antibody |
abx027768-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
BAG Family Molecular Chaperone Regulator 2 (BAG2) Antibody |
abx018673-100ul |
Abbexa |
100 ul |
EUR 342 |
- Shipped within 5-10 working days.
|
BAG Family Molecular Chaperone Regulator 2 (BAG2) Antibody |
20-abx321608 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BAG Family Molecular Chaperone Regulator 2 (BAG2) Antibody |
abx432391-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
BAG Family Molecular Chaperone Regulator 2 (BAG2) Antibody |
20-abx225057 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
BAG2 sgRNA CRISPR Lentivector set (Human) |
K0166801 |
ABM |
3 x 1.0 ug |
EUR 339 |
BAG2 Rabbit Polyclonal Antibody