BCL7C Rabbit Polyclonal Antibody
BCL7C Polyclonal Antibody |
ABP57895-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human BCL7C protein
- Applications tips:
|
Description: A polyclonal antibody for detection of BCL7C from Human, Mouse. This BCL7C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BCL7C protein |
BCL7C Polyclonal Antibody |
42666-100ul |
SAB |
100ul |
EUR 333 |
Polyclonal BCL7C polyclonal antibody |
APR00452G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BCL7C polyclonal . This antibody is tested and proven to work in the following applications: |
BCL7C Polyclonal Conjugated Antibody |
C42666 |
SAB |
100ul |
EUR 397 |
BCL7C antibody |
70R-15981 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal BCL7C antibody |
BCL7C Antibody |
DF2587 |
Affbiotech |
200ul |
EUR 304 |
Description: BCL7C antibody detects endogenous levels of total BCL7C. |
BCL7C Antibody |
1-CSB-PA002629GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against BCL7C. Recognizes BCL7C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
BCL7C Antibody |
1-CSB-PA845147DSR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against BCL7C. Recognizes BCL7C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Anti-BCL7C antibody |
STJ191918 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to BCL7C |
BCL7C siRNA |
20-abx909000 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BCL7C siRNA |
20-abx909001 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BCL7C Protein |
20-abx262722 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
anti-BCL7C |
YF-PA16209 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to BCL7C |
BCL7C Blocking Peptide |
DF2587-BP |
Affbiotech |
1mg |
EUR 195 |
BCL7C cloning plasmid |
CSB-CL845147HU1-10ug |
Cusabio |
10ug |
EUR 293 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 654
- Sequence: atggccggccggactgtacgggccgagacccggagccgggccaaggatgacatcaagaaggtgatggcgaccatcgagaaggtccggagatgggagaagcgatgggtgactgtgggcgacacttcccttcgtatcttcaagtgggtgccagtggtggatccccaggaggaggagcg
- Show more
|
Description: A cloning plasmid for the BCL7C gene. |
BCL7C cloning plasmid |
CSB-CL845147HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 729
- Sequence: atggccggccggactgtacgggccgagacccggagccgggccaaggatgacatcaagaaggtgatggcgaccatcgagaaggtccggagatgggagaagcgatgggtgactgtgggcgacacttcccttcgtatcttcaagtgggtgccagtggtggatccccaggaggaggagcg
- Show more
|
Description: A cloning plasmid for the BCL7C gene. |
Anti-BCL7C (5F1) |
YF-MA16761 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to BCL7C |
Anti-BCL7C (1A4) |
YF-MA16762 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to BCL7C |
BCL Tumor Suppressor 7C (BCL7C) Antibody |
20-abx111193 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human BCL7C shRNA Plasmid |
20-abx956140 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
BCL7C protein (His tag) |
80R-3579 |
Fitzgerald |
50 ug |
EUR 424 |
Description: Purified recombinant BCL7C protein (His tag) |
Mouse BCL7C shRNA Plasmid |
20-abx969338 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
BCL7C Recombinant Protein (Human) |
RP002959 |
ABM |
100 ug |
Ask for price |
BCL7C Recombinant Protein (Human) |
RP002962 |
ABM |
100 ug |
Ask for price |
BCL7C Recombinant Protein (Rat) |
RP192053 |
ABM |
100 ug |
Ask for price |
BCL7C Recombinant Protein (Mouse) |
RP119345 |
ABM |
100 ug |
Ask for price |
Monoclonal BCL7C Antibody (monoclonal) (M01), Clone: 5F1 |
AMM03284G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human BCL7C (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5F1. This antibody is applicable in WB, E |
BCL7C ORF Vector (Human) (pORF) |
ORF000987 |
ABM |
1.0 ug DNA |
EUR 95 |
BCL7C ORF Vector (Human) (pORF) |
ORF000988 |
ABM |
1.0 ug DNA |
EUR 95 |
Bcl7c ORF Vector (Mouse) (pORF) |
ORF039783 |
ABM |
1.0 ug DNA |
EUR 506 |
Bcl7c ORF Vector (Rat) (pORF) |
ORF064019 |
ABM |
1.0 ug DNA |
EUR 506 |
BCL7C sgRNA CRISPR Lentivector set (Human) |
K0176601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Bcl7c sgRNA CRISPR Lentivector set (Mouse) |
K3239201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Bcl7c sgRNA CRISPR Lentivector set (Rat) |
K6627601 |
ABM |
3 x 1.0 ug |
EUR 339 |
BCL7C sgRNA CRISPR Lentivector (Human) (Target 1) |
K0176602 |
ABM |
1.0 ug DNA |
EUR 154 |
BCL7C sgRNA CRISPR Lentivector (Human) (Target 2) |
K0176603 |
ABM |
1.0 ug DNA |
EUR 154 |
BCL7C sgRNA CRISPR Lentivector (Human) (Target 3) |
K0176604 |
ABM |
1.0 ug DNA |
EUR 154 |
Bcl7c sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3239202 |
ABM |
1.0 ug DNA |
EUR 154 |
Bcl7c sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3239203 |
ABM |
1.0 ug DNA |
EUR 154 |
Bcl7c sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3239204 |
ABM |
1.0 ug DNA |
EUR 154 |
Bcl7c sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6627602 |
ABM |
1.0 ug DNA |
EUR 154 |
Bcl7c sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6627603 |
ABM |
1.0 ug DNA |
EUR 154 |
Bcl7c sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6627604 |
ABM |
1.0 ug DNA |
EUR 154 |
BCL7C Protein Vector (Human) (pPB-C-His) |
PV003945 |
ABM |
500 ng |
EUR 329 |
BCL7C Protein Vector (Human) (pPB-N-His) |
PV003946 |
ABM |
500 ng |
EUR 329 |
BCL7C Protein Vector (Human) (pPM-C-HA) |
PV003947 |
ABM |
500 ng |
EUR 329 |
BCL7C Protein Vector (Human) (pPM-C-His) |
PV003948 |
ABM |
500 ng |
EUR 329 |
BCL7C Protein Vector (Human) (pPB-C-His) |
PV003949 |
ABM |
500 ng |
EUR 329 |
BCL7C Protein Vector (Human) (pPB-N-His) |
PV003950 |
ABM |
500 ng |
EUR 329 |
BCL7C Protein Vector (Human) (pPM-C-HA) |
PV003951 |
ABM |
500 ng |
EUR 329 |
BCL7C Protein Vector (Human) (pPM-C-His) |
PV003952 |
ABM |
500 ng |
EUR 329 |
Recombinant Human BCL7C Protein, His, E.coli-10ug |
QP11147-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human BCL7C Protein, His, E.coli-1mg |
QP11147-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human BCL7C Protein, His, E.coli-2ug |
QP11147-2ug |
EnQuireBio |
2ug |
EUR 155 |
BCL7C Protein Vector (Human) (pPB-His-MBP) |
PV326594 |
ABM |
500 ng |
EUR 329 |
BCL7C Protein Vector (Human) (pPB-His-GST) |
PV326595 |
ABM |
500 ng |
EUR 329 |
BCL7C Protein Vector (Human) (pPB-His-MBP) |
PV326598 |
ABM |
500 ng |
EUR 329 |
BCL7C Protein Vector (Human) (pPB-His-GST) |
PV326599 |
ABM |
500 ng |
EUR 329 |
BCL7C Protein Vector (Rat) (pPB-C-His) |
PV256074 |
ABM |
500 ng |
EUR 603 |
BCL7C Protein Vector (Rat) (pPB-N-His) |
PV256075 |
ABM |
500 ng |
EUR 603 |
BCL7C Protein Vector (Rat) (pPM-C-HA) |
PV256076 |
ABM |
500 ng |
EUR 603 |
BCL7C Protein Vector (Rat) (pPM-C-His) |
PV256077 |
ABM |
500 ng |
EUR 603 |
BCL7C Protein Vector (Mouse) (pPB-C-His) |
PV159130 |
ABM |
500 ng |
EUR 603 |
BCL7C Protein Vector (Mouse) (pPB-N-His) |
PV159131 |
ABM |
500 ng |
EUR 603 |
BCL7C Protein Vector (Mouse) (pPM-C-HA) |
PV159132 |
ABM |
500 ng |
EUR 603 |
BCL7C Protein Vector (Mouse) (pPM-C-His) |
PV159133 |
ABM |
500 ng |
EUR 603 |
Bcl7c 3'UTR Luciferase Stable Cell Line |
TU201284 |
ABM |
1.0 ml |
Ask for price |
Bcl7c 3'UTR GFP Stable Cell Line |
TU152696 |
ABM |
1.0 ml |
Ask for price |
BCL7C 3'UTR Luciferase Stable Cell Line |
TU001707 |
ABM |
1.0 ml |
EUR 1394 |
Bcl7c 3'UTR Luciferase Stable Cell Line |
TU102696 |
ABM |
1.0 ml |
Ask for price |
BCL7C 3'UTR GFP Stable Cell Line |
TU051707 |
ABM |
1.0 ml |
EUR 1394 |
Bcl7c 3'UTR GFP Stable Cell Line |
TU251284 |
ABM |
1.0 ml |
Ask for price |
Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) ELISA kit |
E04B0774-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) ELISA kit |
E04B0774-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) ELISA kit |
E04B0774-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
BCL7C Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV707823 |
ABM |
1.0 ug DNA |
EUR 316 |
BCL7C Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV707827 |
ABM |
1.0 ug DNA |
EUR 316 |
BCL7C Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV707828 |
ABM |
1.0 ug DNA |
EUR 316 |
BCL7C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV621379 |
ABM |
1.0 ug DNA |
EUR 514 |
BCL7C Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV621383 |
ABM |
1.0 ug DNA |
EUR 514 |
BCL7C Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV621384 |
ABM |
1.0 ug DNA |
EUR 514 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
BCL7C Rabbit Polyclonal Antibody