BCL7C Rabbit Polyclonal Antibody

BCL7C Rabbit Polyclonal Antibody

BCL7C Polyclonal Antibody

ABP57895-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BCL7C protein
  • Applications tips:
Description: A polyclonal antibody for detection of BCL7C from Human, Mouse. This BCL7C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BCL7C protein

BCL7C Polyclonal Antibody

42666-100ul 100ul
EUR 333

Polyclonal BCL7C polyclonal antibody

APR00452G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BCL7C polyclonal . This antibody is tested and proven to work in the following applications:

BCL7C Polyclonal Conjugated Antibody

C42666 100ul
EUR 397

BCL7C Antibody

ABD2587 100 ug
EUR 438

BCL7C antibody

70R-15981 50 ul
EUR 435
Description: Rabbit polyclonal BCL7C antibody

BCL7C Antibody

DF2587 200ul
EUR 304
Description: BCL7C antibody detects endogenous levels of total BCL7C.

BCL7C Antibody

1-CSB-PA002629GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BCL7C. Recognizes BCL7C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

BCL7C Antibody

1-CSB-PA845147DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BCL7C. Recognizes BCL7C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Anti-BCL7C antibody

STJ191918 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BCL7C

BCL7C siRNA

20-abx909000
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BCL7C siRNA

20-abx909001
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BCL7C Protein

20-abx262722
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

anti-BCL7C

YF-PA16209 50 ul
EUR 363
Description: Mouse polyclonal to BCL7C

BCL7C Blocking Peptide

DF2587-BP 1mg
EUR 195

BCL7C cloning plasmid

CSB-CL845147HU1-10ug 10ug
EUR 293
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggccggccggactgtacgggccgagacccggagccgggccaaggatgacatcaagaaggtgatggcgaccatcgagaaggtccggagatgggagaagcgatgggtgactgtgggcgacacttcccttcgtatcttcaagtgggtgccagtggtggatccccaggaggaggagcg
  • Show more
Description: A cloning plasmid for the BCL7C gene.

BCL7C cloning plasmid

CSB-CL845147HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 729
  • Sequence: atggccggccggactgtacgggccgagacccggagccgggccaaggatgacatcaagaaggtgatggcgaccatcgagaaggtccggagatgggagaagcgatgggtgactgtgggcgacacttcccttcgtatcttcaagtgggtgccagtggtggatccccaggaggaggagcg
  • Show more
Description: A cloning plasmid for the BCL7C gene.

Anti-BCL7C (5F1)

YF-MA16761 100 ug
EUR 363
Description: Mouse monoclonal to BCL7C

Anti-BCL7C (1A4)

YF-MA16762 100 ug
EUR 363
Description: Mouse monoclonal to BCL7C

BCL Tumor Suppressor 7C (BCL7C) Antibody

20-abx111193
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse Bcl7c ELISA KIT

ELI-25376m 96 Tests
EUR 865

Human BCL7C ELISA KIT

ELI-49954h 96 Tests
EUR 824

Human BCL7C shRNA Plasmid

20-abx956140
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BCL7C protein (His tag)

80R-3579 50 ug
EUR 424
Description: Purified recombinant BCL7C protein (His tag)

Mouse BCL7C shRNA Plasmid

20-abx969338
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BCL7C Recombinant Protein (Human)

RP002959 100 ug Ask for price

BCL7C Recombinant Protein (Human)

RP002962 100 ug Ask for price

BCL7C Recombinant Protein (Rat)

RP192053 100 ug Ask for price

BCL7C Recombinant Protein (Mouse)

RP119345 100 ug Ask for price

Monoclonal BCL7C Antibody (monoclonal) (M01), Clone: 5F1

AMM03284G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human BCL7C (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5F1. This antibody is applicable in WB, E

BCL7C ORF Vector (Human) (pORF)

ORF000987 1.0 ug DNA
EUR 95

BCL7C ORF Vector (Human) (pORF)

ORF000988 1.0 ug DNA
EUR 95

Bcl7c ORF Vector (Mouse) (pORF)

ORF039783 1.0 ug DNA
EUR 506

Bcl7c ORF Vector (Rat) (pORF)

ORF064019 1.0 ug DNA
EUR 506

BCL7C sgRNA CRISPR Lentivector set (Human)

K0176601 3 x 1.0 ug
EUR 339

Bcl7c sgRNA CRISPR Lentivector set (Mouse)

K3239201 3 x 1.0 ug
EUR 339

Bcl7c sgRNA CRISPR Lentivector set (Rat)

K6627601 3 x 1.0 ug
EUR 339

BCL7C sgRNA CRISPR Lentivector (Human) (Target 1)

K0176602 1.0 ug DNA
EUR 154

BCL7C sgRNA CRISPR Lentivector (Human) (Target 2)

K0176603 1.0 ug DNA
EUR 154

BCL7C sgRNA CRISPR Lentivector (Human) (Target 3)

K0176604 1.0 ug DNA
EUR 154

Bcl7c sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3239202 1.0 ug DNA
EUR 154

Bcl7c sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3239203 1.0 ug DNA
EUR 154

Bcl7c sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3239204 1.0 ug DNA
EUR 154

Bcl7c sgRNA CRISPR Lentivector (Rat) (Target 1)

K6627602 1.0 ug DNA
EUR 154

Bcl7c sgRNA CRISPR Lentivector (Rat) (Target 2)

K6627603 1.0 ug DNA
EUR 154

Bcl7c sgRNA CRISPR Lentivector (Rat) (Target 3)

K6627604 1.0 ug DNA
EUR 154

BCL7C Protein Vector (Human) (pPB-C-His)

PV003945 500 ng
EUR 329

BCL7C Protein Vector (Human) (pPB-N-His)

PV003946 500 ng
EUR 329

BCL7C Protein Vector (Human) (pPM-C-HA)

PV003947 500 ng
EUR 329

BCL7C Protein Vector (Human) (pPM-C-His)

PV003948 500 ng
EUR 329

BCL7C Protein Vector (Human) (pPB-C-His)

PV003949 500 ng
EUR 329

BCL7C Protein Vector (Human) (pPB-N-His)

PV003950 500 ng
EUR 329

BCL7C Protein Vector (Human) (pPM-C-HA)

PV003951 500 ng
EUR 329

BCL7C Protein Vector (Human) (pPM-C-His)

PV003952 500 ng
EUR 329

Recombinant Human BCL7C Protein, His, E.coli-10ug

QP11147-10ug 10ug
EUR 201

Recombinant Human BCL7C Protein, His, E.coli-1mg

QP11147-1mg 1mg
EUR 5251

Recombinant Human BCL7C Protein, His, E.coli-2ug

QP11147-2ug 2ug
EUR 155

BCL7C Protein Vector (Human) (pPB-His-MBP)

PV326594 500 ng
EUR 329

BCL7C Protein Vector (Human) (pPB-His-GST)

PV326595 500 ng
EUR 329

BCL7C Protein Vector (Human) (pPB-His-MBP)

PV326598 500 ng
EUR 329

BCL7C Protein Vector (Human) (pPB-His-GST)

PV326599 500 ng
EUR 329

BCL7C Protein Vector (Rat) (pPB-C-His)

PV256074 500 ng
EUR 603

BCL7C Protein Vector (Rat) (pPB-N-His)

PV256075 500 ng
EUR 603

BCL7C Protein Vector (Rat) (pPM-C-HA)

PV256076 500 ng
EUR 603

BCL7C Protein Vector (Rat) (pPM-C-His)

PV256077 500 ng
EUR 603

BCL7C Protein Vector (Mouse) (pPB-C-His)

PV159130 500 ng
EUR 603

BCL7C Protein Vector (Mouse) (pPB-N-His)

PV159131 500 ng
EUR 603

BCL7C Protein Vector (Mouse) (pPM-C-HA)

PV159132 500 ng
EUR 603

BCL7C Protein Vector (Mouse) (pPM-C-His)

PV159133 500 ng
EUR 603

Bcl7c 3'UTR Luciferase Stable Cell Line

TU201284 1.0 ml Ask for price

Bcl7c 3'UTR GFP Stable Cell Line

TU152696 1.0 ml Ask for price

BCL7C 3'UTR Luciferase Stable Cell Line

TU001707 1.0 ml
EUR 1394

Bcl7c 3'UTR Luciferase Stable Cell Line

TU102696 1.0 ml Ask for price

BCL7C 3'UTR GFP Stable Cell Line

TU051707 1.0 ml
EUR 1394

Bcl7c 3'UTR GFP Stable Cell Line

TU251284 1.0 ml Ask for price

Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) ELISA kit

E04B0774-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) ELISA kit

E04B0774-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) ELISA kit

E04B0774-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit B cell CLL/lymphoma 7 protein family member C(BCL7C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

BCL7C Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV707823 1.0 ug DNA
EUR 316

BCL7C Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV707827 1.0 ug DNA
EUR 316

BCL7C Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV707828 1.0 ug DNA
EUR 316

BCL7C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV621379 1.0 ug DNA
EUR 514

BCL7C Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV621383 1.0 ug DNA
EUR 514

BCL7C Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV621384 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

BCL7C Rabbit Polyclonal Antibody