BIN2 Rabbit Polyclonal Antibody

BIN2 Rabbit Polyclonal Antibody

BIN2 Polyclonal Antibody

ABP57900-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of BIN2 from Human. This BIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIN2 protein at amino acid sequence of 260-340

BIN2 Polyclonal Antibody

A68471 100 ?g
EUR 628.55
Description: reagents widely cited

Human Bridging Integrator 2 (BIN2) ELISA Kit

DLR-BIN2-Hu-48T 48T
EUR 517
  • Should the Human Bridging Integrator 2 (BIN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Bridging Integrator 2 (BIN2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Bridging Integrator 2 (BIN2) ELISA Kit

DLR-BIN2-Hu-96T 96T
EUR 673
  • Should the Human Bridging Integrator 2 (BIN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Bridging Integrator 2 (BIN2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Bridging Integrator 2 (BIN2) ELISA Kit

RD-BIN2-Hu-48Tests 48 Tests
EUR 521

Human Bridging Integrator 2 (BIN2) ELISA Kit

RD-BIN2-Hu-96Tests 96 Tests
EUR 723

Human Bridging Integrator 2 (BIN2) ELISA Kit

RDR-BIN2-Hu-48Tests 48 Tests
EUR 544

Human Bridging Integrator 2 (BIN2) ELISA Kit

RDR-BIN2-Hu-96Tests 96 Tests
EUR 756

BIN2 antibody

70R-33216 100 ug
EUR 435
Description: Rabbit polyclonal BIN2 antibody

BIN2 antibody

70R-9452 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal BIN2 antibody

BIN2 Antibody

ABD2479 100 ug
EUR 438

BIN2 Antibody

44791-100ul 100ul
EUR 252

BIN2 Antibody

44791-50ul 50ul
EUR 187

BIN2 antibody

70R-15997 50 ul
EUR 435
Description: Rabbit polyclonal BIN2 antibody

BIN2 Antibody

DF2479 200ul
EUR 304
Description: BIN2 antibody detects endogenous levels of total BIN2.

BIN2 Antibody

1-CSB-PA002701GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against BIN2. Recognizes BIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

BIN2 Antibody

1-CSB-PA002701LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIN2. Recognizes BIN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:20-1:200

BIN2 Polyclonal Antibody, HRP Conjugated

A68472 100 ?g
EUR 628.55
Description: Ask the seller for details

BIN2 Polyclonal Antibody, FITC Conjugated

A68473 100 ?g
EUR 628.55
Description: The best epigenetics products

BIN2 Polyclonal Antibody, Biotin Conjugated

A68474 100 ?g
EUR 628.55
Description: kits suitable for this type of research

Bin2/ Rat Bin2 ELISA Kit

ELI-33315r 96 Tests
EUR 886

BIN2 Conjugated Antibody

C44791 100ul
EUR 397

anti- BIN2 antibody

FNab00898 100µg
EUR 505.25
  • Immunogen: bridging integrator 2
  • Uniprot ID: Q9UBW5
  • Gene ID: 51411
  • Research Area: Neuroscience
Description: Antibody raised against BIN2

Anti-BIN2 antibody

PAab00898 100 ug
EUR 355

Anti-BIN2 antibody

STJ191822 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BIN2

BIN2 siRNA

20-abx909110
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BIN2 siRNA

20-abx909111
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human)

4-PAJ554Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2)

BIN2 Antibody, HRP conjugated

1-CSB-PA002701LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIN2. Recognizes BIN2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BIN2 Antibody, FITC conjugated

1-CSB-PA002701LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIN2. Recognizes BIN2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BIN2 Antibody, Biotin conjugated

1-CSB-PA002701LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIN2. Recognizes BIN2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), APC

4-PAJ554Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with APC.

Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), Biotinylated

4-PAJ554Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with Biotin.

Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), Cy3

4-PAJ554Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with Cy3.

Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), FITC

4-PAJ554Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with FITC.

Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), HRP

4-PAJ554Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with HRP.

Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), PE

4-PAJ554Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with PE.

BIN2 cloning plasmid

CSB-CL002701HU-10ug 10ug
EUR 586
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1698
  • Sequence: atggcagagggcaaggcaggcggcgcggccggcctcttcgccaagcaggtgcagaagaagtttagcagggcccaggagaaggtgctgcagaaattggggaaagctgtagaaaccaaagatgaacgatttgaacaaagcgctagcaacttctaccaacaacaggcagaaggccaca
  • Show more
Description: A cloning plasmid for the BIN2 gene.

BIN2 Blocking Peptide

33R-2395 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BIN2 antibody, catalog no. 70R-9452

BIN2 Blocking Peptide

DF2479-BP 1mg
EUR 195

pCMV-SPORT6-BIN2

PVT19147 2 ug
EUR 231

Bridging Integrator 2 (BIN2) Antibody

20-abx111263
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bridging Integrator 2 (BIN2) Antibody

20-abx130730
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Bridging Integrator 2 (BIN2) Antibody

20-abx148626
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bridging Integrator 2 (BIN2) Antibody

abx032613-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Bridging Integrator 2 (BIN2) Antibody

abx032613-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Bridging Integrator 2 (BIN2) Antibody

20-abx333696
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bridging Integrator 2 (BIN2) Antibody

abx230898-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Bridging Integrator 2 (BIN2) Antibody

20-abx171480
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Bridging Integrator 2 (BIN2) Polyclonal Antibody (Human), APC-Cy7

4-PAJ554Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BIN2 (Met1~Asn244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Bridging Integrator 2 (BIN2). This antibody is labeled with APC-Cy7.

BIN2 ELISA KIT|Human

EF008118 96 Tests
EUR 689

BIN2 Rabbit Polyclonal Antibody