BUB1B Rabbit Polyclonal Antibody
BUB1B Polyclonal Antibody |
ES10806-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against BUB1B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
BUB1B Rabbit pAb |
A14525-100ul |
Abclonal |
100 ul |
EUR 308 |
BUB1B Rabbit pAb |
A14525-200ul |
Abclonal |
200 ul |
EUR 459 |
BUB1B Rabbit pAb |
A14525-20ul |
Abclonal |
20 ul |
EUR 183 |
BUB1B Rabbit pAb |
A14525-50ul |
Abclonal |
50 ul |
EUR 223 |
BUB1B Rabbit pAb |
A1775-100ul |
Abclonal |
100 ul |
EUR 308 |
BUB1B Rabbit pAb |
A1775-200ul |
Abclonal |
200 ul |
EUR 459 |
BUB1B Rabbit pAb |
A1775-20ul |
Abclonal |
20 ul |
EUR 183 |
BUB1B Rabbit pAb |
A1775-50ul |
Abclonal |
50 ul |
EUR 223 |
BUB1B antibody |
70R-16046 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal BUB1B antibody |
BUB1B Antibody |
32428-100ul |
SAB |
100ul |
EUR 252 |
BUB1B antibody |
10R-1666 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal BUB1B antibody |
BUB1B antibody |
10R-3513 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal BUB1B antibody |
BUB1B antibody |
10R-3514 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal BUB1B antibody |
BUB1B antibody |
10R-3515 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal BUB1B antibody |
BUB1B antibody |
10R-3516 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal BUB1B antibody |
BUB1B antibody |
10R-3517 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal BUB1B antibody |
BUB1B antibody |
10R-3518 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal BUB1B antibody |
BUB1B antibody |
10R-3519 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal BUB1B antibody |
BUB1B antibody |
10R-3520 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal BUB1B antibody |
BUB1B antibody |
10R-3521 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal BUB1B antibody |
BUB1B antibody |
10R-3522 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal BUB1B antibody |
BUB1B Antibody |
1-CSB-PA001071 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
BUB1B Antibody |
1-CSB-PA002883GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
BUB1B Antibody |
CSB-PA002883KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
BUB1B Antibody |
CSB-PA002883KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
BUB1B Antibody |
1-CSB-PA002883LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF, IP; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:500, IP:1:200-1:2000 |
BUB1B Antibody |
DF2657 |
Affbiotech |
200ul |
EUR 304 |
Description: BUB1B antibody detects endogenous levels of total BUB1B. |
BUB1B Antibody |
DF3033 |
Affbiotech |
200ul |
EUR 304 |
Description: BUB1B Antibody detects endogenous levels of total BUB1B. |
BUB1B Antibody |
DF6609 |
Affbiotech |
200ul |
EUR 304 |
Description: BUB1B Antibody detects endogenous levels of total BUB1B. |
BUB1B antibody |
70R-33725 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal BUB1B antibody |
BUB1B Conjugated Antibody |
C32428 |
SAB |
100ul |
EUR 397 |
Anti-BUB1B antibody |
STJ116736 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. |
Anti-BUB1B antibody |
STJ22847 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. |
Anti-BUB1B antibody |
STJ191964 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to BUB1B |
BUB1B siRNA |
20-abx909410 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BUB1B siRNA |
20-abx909411 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BUB1B Antibody, HRP conjugated |
1-CSB-PA002883LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
BUB1B Antibody, FITC conjugated |
1-CSB-PA002883LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
BUB1B Antibody, Biotin conjugated |
1-CSB-PA002883LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-BubR1/BUB1B Antibody |
A01564-1 |
BosterBio |
100ug/vial |
EUR 334 |
BUB1B Blocking Peptide |
DF2657-BP |
Affbiotech |
1mg |
EUR 195 |
BUB1B Blocking Peptide |
DF3033-BP |
Affbiotech |
1mg |
EUR 195 |
BUB1B Blocking Peptide |
DF6609-BP |
Affbiotech |
1mg |
EUR 195 |
BUB1B cloning plasmid |
CSB-CL002883HU-10ug |
Cusabio |
10ug |
EUR 1161 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3153
- Sequence: atggcggcggtgaagaaggaagggggtgctctgagtgaagccatgtccctggagggagatgaatgggaactgagtaaagaaaatgtacaacctttaaggcaagggcggatcatgtccacgcttcagggagcactggcacaagaatctgcctgtaacaatactcttcagcagcaga
- Show more
|
Description: A cloning plasmid for the BUB1B gene. |
Mouse BUB1B shRNA Plasmid |
20-abx969404 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human BUB1B shRNA Plasmid |
20-abx950486 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Monoclonal BUB1B Antibody (monoclonal) (M01), Clone: 2G9 |
AMM03292G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human BUB1B (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G9. This antibody is applicable in WB, IHC and IF |
BUB1B ORF Vector (Human) (pORF) |
ORF001101 |
ABM |
1.0 ug DNA |
EUR 95 |
Bub1b ORF Vector (Mouse) (pORF) |
ORF040050 |
ABM |
1.0 ug DNA |
EUR 506 |
BUB1B ELISA Kit (Mouse) (OKCA01721) |
OKCA01721 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Essential component of the mitotic checkpoint. Required for normal mitosis progression and tumor suppression. The mitotic checkpoint delays anaphase until all chromosomes are properly attached to the mitotic spindle. One of its checkpoint functions is to inhibit the activity of the anaphase-promoting complex/cyclosome (APC/C) by blocking the binding of CDC20 to APC/C, independently of its kinase activity. The other is to monitor kinetochore activities that depend on the kinetochore motor CENPE. Required for kinetochore localization of CENPE. Negatively regulates PLK1 activity in interphase cells and suppresses centrosome amplification. Also implicated in triggering apoptosis in polyploid cells that exit aberrantly from mitotic arrest. Essential for tumor suppression. May play a role in regulating aging and fertility.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 9.38 pg/mL |
Monoclonal BUB1B / BubR1 Antibody (clone 2G5), Clone: 2G5 |
AMM01904G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human BUB1B / BubR1 (clone 2G5). The antibodies are raised in Mouse and are from clone 2G5. This antibody is applicable in WB and IHC-P, E, PLA, RNAi |
Monoclonal BUB1B / BubR1 Antibody (clone 3F2), Clone: 3F2 |
AMM01905G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human BUB1B / BubR1 (clone 3F2). The antibodies are raised in Mouse and are from clone 3F2. This antibody is applicable in WB and IHC-P, E |
Bub1b sgRNA CRISPR Lentivector set (Mouse) |
K4944601 |
ABM |
3 x 1.0 ug |
EUR 339 |
BUB1B sgRNA CRISPR Lentivector set (Human) |
K0202701 |
ABM |
3 x 1.0 ug |
EUR 339 |
BUB1 Mitotic Checkpoint Serine/threonine Kinase B (BUB1B) Antibody |
20-abx325486 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bub1b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4944602 |
ABM |
1.0 ug DNA |
EUR 154 |
Bub1b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4944603 |
ABM |
1.0 ug DNA |
EUR 154 |
BUB1B Rabbit Polyclonal Antibody