BUB1B Rabbit Polyclonal Antibody

BUB1B Rabbit Polyclonal Antibody

BUB1B Polyclonal Antibody

ES10806-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BUB1B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

BUB1B Rabbit pAb

A14525-100ul 100 ul
EUR 308

BUB1B Rabbit pAb

A14525-200ul 200 ul
EUR 459

BUB1B Rabbit pAb

A14525-20ul 20 ul
EUR 183

BUB1B Rabbit pAb

A14525-50ul 50 ul
EUR 223

BUB1B Rabbit pAb

A1775-100ul 100 ul
EUR 308

BUB1B Rabbit pAb

A1775-200ul 200 ul
EUR 459

BUB1B Rabbit pAb

A1775-20ul 20 ul
EUR 183

BUB1B Rabbit pAb

A1775-50ul 50 ul
EUR 223

BUB1B antibody

70R-16046 50 ul
EUR 435
Description: Rabbit polyclonal BUB1B antibody

BUB1B Antibody

32428-100ul 100ul
EUR 252

BUB1B antibody

10R-1666 100 ug
EUR 512
Description: Mouse monoclonal BUB1B antibody

BUB1B antibody

10R-3513 100 ul
EUR 726
Description: Mouse monoclonal BUB1B antibody

BUB1B antibody

10R-3514 100 ul
EUR 691
Description: Mouse monoclonal BUB1B antibody

BUB1B antibody

10R-3515 100 ul
EUR 691
Description: Mouse monoclonal BUB1B antibody

BUB1B antibody

10R-3516 100 ul
EUR 691
Description: Mouse monoclonal BUB1B antibody

BUB1B antibody

10R-3517 100 ul
EUR 691
Description: Mouse monoclonal BUB1B antibody

BUB1B antibody

10R-3518 100 ul
EUR 691
Description: Mouse monoclonal BUB1B antibody

BUB1B antibody

10R-3519 100 ul
EUR 691
Description: Mouse monoclonal BUB1B antibody

BUB1B antibody

10R-3520 100 ul
EUR 691
Description: Mouse monoclonal BUB1B antibody

BUB1B antibody

10R-3521 100 ul
EUR 691
Description: Mouse monoclonal BUB1B antibody

BUB1B antibody

10R-3522 100 ul
EUR 691
Description: Mouse monoclonal BUB1B antibody

BUB1B Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

BUB1B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

BUB1B Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

BUB1B Antibody

CSB-PA002883KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

BUB1B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF, IP; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:500, IP:1:200-1:2000

BUB1B Antibody

DF2657 200ul
EUR 304
Description: BUB1B antibody detects endogenous levels of total BUB1B.

BUB1B Antibody

DF3033 200ul
EUR 304
Description: BUB1B Antibody detects endogenous levels of total BUB1B.

BUB1B Antibody

DF6609 200ul
EUR 304
Description: BUB1B Antibody detects endogenous levels of total BUB1B.

BUB1B antibody

70R-33725 100 ug
EUR 327
Description: Rabbit polyclonal BUB1B antibody

BUB1B Antibody

ABD2657 100 ug
EUR 438

BUB1B Antibody

ABD3033 100 ug
EUR 438

BUB1B Antibody

ABD6609 100 ug
EUR 438

BUB1B Conjugated Antibody

C32428 100ul
EUR 397

Anti-BUB1B antibody

STJ116736 100 µl
EUR 277
Description: This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer.

Anti-BUB1B antibody

STJ22847 100 µl
EUR 277
Description: This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer.

Anti-BUB1B antibody

STJ191964 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BUB1B


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BUB1B Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BUB1B Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BUB1B Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BUB1B. Recognizes BUB1B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-BubR1/BUB1B Antibody

A01564-1 100ug/vial
EUR 334

BUB1B Blocking Peptide

DF2657-BP 1mg
EUR 195

BUB1B Blocking Peptide

DF3033-BP 1mg
EUR 195

BUB1B Blocking Peptide

DF6609-BP 1mg
EUR 195

BUB1B cloning plasmid

CSB-CL002883HU-10ug 10ug
EUR 1161
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3153
  • Sequence: atggcggcggtgaagaaggaagggggtgctctgagtgaagccatgtccctggagggagatgaatgggaactgagtaaagaaaatgtacaacctttaaggcaagggcggatcatgtccacgcttcagggagcactggcacaagaatctgcctgtaacaatactcttcagcagcaga
  • Show more
Description: A cloning plasmid for the BUB1B gene.


ELI-11200h 96 Tests
EUR 824

Mouse BUB1B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BUB1B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Bub1b ELISA KIT

ELI-50145m 96 Tests
EUR 865

Monoclonal BUB1B Antibody (monoclonal) (M01), Clone: 2G9

AMM03292G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human BUB1B (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G9. This antibody is applicable in WB, IHC and IF

BUB1B ORF Vector (Human) (pORF)

ORF001101 1.0 ug DNA
EUR 95

Bub1b ORF Vector (Mouse) (pORF)

ORF040050 1.0 ug DNA
EUR 506

BUB1B ELISA Kit (Mouse) (OKCA01721)

OKCA01721 96 Wells
EUR 846
Description: Description of target: Essential component of the mitotic checkpoint. Required for normal mitosis progression and tumor suppression. The mitotic checkpoint delays anaphase until all chromosomes are properly attached to the mitotic spindle. One of its checkpoint functions is to inhibit the activity of the anaphase-promoting complex/cyclosome (APC/C) by blocking the binding of CDC20 to APC/C, independently of its kinase activity. The other is to monitor kinetochore activities that depend on the kinetochore motor CENPE. Required for kinetochore localization of CENPE. Negatively regulates PLK1 activity in interphase cells and suppresses centrosome amplification. Also implicated in triggering apoptosis in polyploid cells that exit aberrantly from mitotic arrest. Essential for tumor suppression. May play a role in regulating aging and fertility.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 9.38 pg/mL

Monoclonal BUB1B / BubR1 Antibody (clone 2G5), Clone: 2G5

AMM01904G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human BUB1B / BubR1 (clone 2G5). The antibodies are raised in Mouse and are from clone 2G5. This antibody is applicable in WB and IHC-P, E, PLA, RNAi

Monoclonal BUB1B / BubR1 Antibody (clone 3F2), Clone: 3F2

AMM01905G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human BUB1B / BubR1 (clone 3F2). The antibodies are raised in Mouse and are from clone 3F2. This antibody is applicable in WB and IHC-P, E

Bub1b sgRNA CRISPR Lentivector set (Mouse)

K4944601 3 x 1.0 ug
EUR 339

BUB1B sgRNA CRISPR Lentivector set (Human)

K0202701 3 x 1.0 ug
EUR 339

BUB1 Mitotic Checkpoint Serine/threonine Kinase B (BUB1B) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bub1b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4944602 1.0 ug DNA
EUR 154

Bub1b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4944603 1.0 ug DNA
EUR 154

BUB1B Rabbit Polyclonal Antibody