Da vinci european bio bank

CANT1 Rabbit Polyclonal Antibody

CANT1 Polyclonal Antibody
ABP57979-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human CANT1 protein Applications tips:
Description: A polyclonal antibody for detection of CANT1 from Human, Mouse. This CANT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CANT1 protein

CANT1 Polyclonal Antibody
ABP57979-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human CANT1 protein Applications tips:
Description: A polyclonal antibody for detection of CANT1 from Human, Mouse. This CANT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CANT1 protein

CANT1 Polyclonal Antibody
A55890	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

CANT1 Rabbit pAb
A6341-100ul	Abclonal	100 ul	EUR 308

CANT1 Rabbit pAb
A6341-200ul	Abclonal	200 ul	EUR 459

CANT1 Rabbit pAb
A6341-20ul	Abclonal	20 ul	EUR 183

CANT1 Rabbit pAb
A6341-50ul	Abclonal	50 ul	EUR 223

CANT1 Rabbit pAb
A10965-100ul	Abclonal	100 ul	EUR 308

CANT1 Rabbit pAb
A10965-200ul	Abclonal	200 ul	EUR 459

CANT1 Rabbit pAb
A10965-20ul	Abclonal	20 ul	Ask for price

CANT1 Rabbit pAb
A10965-50ul	Abclonal	50 ul	Ask for price

CANT1 Rabbit pAb
A14157-100ul	Abclonal	100 ul	EUR 308

CANT1 Rabbit pAb
A14157-200ul	Abclonal	200 ul	EUR 459

CANT1 Rabbit pAb
A14157-20ul	Abclonal	20 ul	EUR 183

CANT1 Rabbit pAb
A14157-50ul	Abclonal	50 ul	EUR 223

CANT1 antibody
70R-5808	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CANT1 antibody raised against the middle region of CANT1

CANT1 antibody
70R-5814	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CANT1 antibody raised against the middle region of CANT1

CANT1 Antibody
ABD2590	Lifescience Market	100 ug	EUR 438

CANT1 antibody
38838-100ul	SAB	100ul	EUR 252

CANT1 antibody
70R-16146	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CANT1 antibody

CANT1 Antibody
DF2590	Affbiotech	200ul	EUR 304
Description: CANT1 antibody detects endogenous levels of total CANT1.

CANT1 Antibody
1-CSB-PA004484GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CANT1 Antibody
1-CSB-PA848824ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CANT1 Antibody
1-CSB-PA13099A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal CANT1 Antibody (N-term)
APR15248G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CANT1 (N-term). This antibody is tested and proven to work in the following applications:

CANT1 Polyclonal Antibody, HRP Conjugated
A55891	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

CANT1 Polyclonal Antibody, FITC Conjugated
A55892	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

CANT1 Polyclonal Antibody, Biotin Conjugated
A55893	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

CANT1 Conjugated Antibody
C38838	SAB	100ul	EUR 397

anti- CANT1 antibody
FNab01245	FN Test	100µg	EUR 548.75
Immunogen: calcium activated nucleotidase 1 Uniprot ID: Q8WVQ1 Gene ID: 124583 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against CANT1

Anti-CANT1 antibody
PAab01245	Lifescience Market	100 ug	EUR 386

Anti-CANT1 antibody
STJ28263	St John's Laboratory	100 µl	EUR 277
Description: This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene.

Anti-CANT1 antibody
STJ112854	St John's Laboratory	100 µl	EUR 277
Description: This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene.

Anti-CANT1 antibody
STJ191921	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CANT1

Anti-CANT1 antibody
STJ116092	St John's Laboratory	100 µl	EUR 277
Description: This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene.

Cant1/ Rat Cant1 ELISA Kit
ELI-11219r	Lifescience Market	96 Tests	EUR 886

CANT1 siRNA
20-abx900773	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CANT1 siRNA
20-abx910225	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CANT1 siRNA
20-abx910226	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Cant1 protein
30R-3248	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant Cant1 protein

Cant1 protein
30R-3249	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant Cant1 protein

anti-CANT1
YF-PA22085	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to CANT1

anti-CANT1
YF-PA22086	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to CANT1

anti-CANT1
YF-PA22087	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to CANT1

CANT1 Antibody, HRP conjugated
1-CSB-PA13099B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CANT1 Antibody, FITC conjugated
1-CSB-PA13099C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CANT1 Antibody, Biotin conjugated
1-CSB-PA13099D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CANT1. Recognizes CANT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human)
4-PAC357Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Ile107~Phe400) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1)

CANT1 Blocking Peptide
33R-8666	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CANT1 antibody, catalog no. 70R-5808

CANT1 Blocking Peptide
33R-9442	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CANT1 antibody, catalog no. 70R-5814

CANT1 Blocking Peptide
DF2590-BP	Affbiotech	1mg	EUR 195

CANT1 cloning plasmid
CSB-CL848824HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1206 Sequence: atgcccgtgcagctgtctgagcacccggaatggaatgagtctatgcactccctccggatcagtgtggggggccttcctgtgctggcgtccatgaccaaggccgcggacccccgcttccgcccccgctggaaggtgatcctgacgttctttgtgggtgctgccatcctctggctgc Show more
Description: A cloning plasmid for the CANT1 gene.

pCMV-SPORT6-CANT1
PVT13149	Lifescience Market	2 ug	EUR 391

Anti-CANT1 (2D3)
YF-MA19809	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CANT1

Anti-CANT1 (1A1)
YF-MA19810	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CANT1

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), APC
4-PAC357Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Ile107~Phe400) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with APC.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), Biotinylated
4-PAC357Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Ile107~Phe400) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with Biotin.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), Cy3
4-PAC357Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Ile107~Phe400) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with Cy3.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), FITC
4-PAC357Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Ile107~Phe400) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with FITC.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), HRP
4-PAC357Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Ile107~Phe400) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with HRP.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), PE
4-PAC357Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Ile107~Phe400) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with PE.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse)
4-PAC357Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Val111~Ile403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1)

Calcium Activated Nucleotidase 1 (CANT1) Antibody
20-abx111298	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody
20-abx131557	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody
20-abx131558	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody
20-abx109378	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody
20-abx270288	Abbexa	EUR 495.00 EUR 578.00 EUR 286.00 EUR 885.00 EUR 370.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-7 working days.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human), APC-Cy7
4-PAC357Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Ile107~Phe400) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with APC-Cy7.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), APC
4-PAC357Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Val111~Ile403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with APC.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC357Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Val111~Ile403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with Biotin.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC357Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Val111~Ile403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with Cy3.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), FITC
4-PAC357Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Val111~Ile403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with FITC.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), HRP
4-PAC357Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Val111~Ile403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with HRP.

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), PE
4-PAC357Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Val111~Ile403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with PE.

Mouse CANT1 shRNA Plasmid
20-abx978539	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat CANT1 shRNA Plasmid
20-abx987972	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CANT1 shRNA Plasmid
20-abx964771	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CANT1 ELISA KIT|Human
EF008369	Lifescience Market	96 Tests	EUR 689

CANT1 protein (His tag)
80R-2080	Fitzgerald	50 ug	EUR 424
Description: Recombinant human CANT1 protein (His tag)

CANT1 Recombinant Protein (Human)
RP005545	ABM	100 ug	Ask for price

CANT1 Recombinant Protein (Rat)
RP193031	ABM	100 ug	Ask for price

CANT1 Recombinant Protein (Mouse)
RP120992	ABM	100 ug	Ask for price

CANT1 Recombinant Protein (Mouse)
RP120995	ABM	100 ug	Ask for price

CANT1 Recombinant Protein (Mouse)
RP120998	ABM	100 ug	Ask for price

Calcium Activated Nucleotidase 1 (CANT1) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC357Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CANT1 (Val111~Ile403) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Calcium Activated Nucleotidase 1 (CANT1). This antibody is labeled with APC-Cy7.

Monoclonal CANT1 Antibody (monoclonal) (M01), Clone: 2D3
APR15247G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human CANT1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2D3. This antibody is applicable in WB, E

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody
20-abx126849	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody (HRP)
20-abx108761	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody (Biotin)
20-abx105925	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Calcium Activated Nucleotidase 1 (CANT1) Antibody (FITC)
20-abx107340	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody
abx034122-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody
abx034122-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody
20-abx004847	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody
20-abx320170	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody
abx231245-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Human CANT1 PicoKine ELISA Kit
EK2109	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human CANT1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

CANT1 ORF Vector (Human) (pORF)
ORF001849	ABM	1.0 ug DNA	EUR 95

Cant1 ORF Vector (Mouse) (pORF)
ORF040332	ABM	1.0 ug DNA	EUR 506

Cant1 ORF Vector (Mouse) (pORF)
ORF040333	ABM	1.0 ug DNA	EUR 506

Cant1 ORF Vector (Mouse) (pORF)
ORF040334	ABM	1.0 ug DNA	EUR 506

Cant1 ORF Vector (Rat) (pORF)
ORF064345	ABM	1.0 ug DNA	EUR 506

CANT1 ELISA Kit (Human) (OKBB01475)
OKBB01475	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: CANT1 is a gene that encodes soluble calcium-activated nucleotidase 1, an enzyme, in humans. It is mapped to 17q25.3. This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Soluble Calcium Activated Nucleotidase 1 (CANT1) Antibody Pair
abx117542-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

CANT1 sgRNA CRISPR Lentivector set (Human)
K0359301	ABM	3 x 1.0 ug	EUR 339

Cant1 sgRNA CRISPR Lentivector set (Mouse)
K4462001	ABM	3 x 1.0 ug	EUR 339

Cant1 sgRNA CRISPR Lentivector set (Rat)
K7219001	ABM	3 x 1.0 ug	EUR 339

Recombinant Calcium Activated Nucleotidase 1 (CANT1)
4-RPC357Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8WVQ1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 36.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Calcium Activated Nucleotidase 1 expressed in: E.coli

Recombinant Calcium Activated Nucleotidase 1 (CANT1)
4-RPC357Mu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8VCF1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 36.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Calcium Activated Nucleotidase 1 expressed in: E.coli

CANT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0359302	ABM	1.0 ug DNA	EUR 154

CANT1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0359303	ABM	1.0 ug DNA	EUR 154

CANT1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0359304	ABM	1.0 ug DNA	EUR 154

Human Calcium Activated Nucleotidase 1 (CANT1) Protein
20-abx168919	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Calcium Activated Nucleotidase 1 (CANT1) Protein
20-abx168920	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cant1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4462002	ABM	1.0 ug DNA	EUR 154

Cant1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4462003	ABM	1.0 ug DNA	EUR 154

Cant1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4462004	ABM	1.0 ug DNA	EUR 154

Human Soluble calcium-activated nucleotidase 1 (CANT1)
1-CSB-RP130944h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 62.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Soluble calcium-activated nucleotidase 1(CANT1),partial expressed in E.coli

Human Soluble calcium-activated nucleotidase 1 (CANT1)
1-CSB-RP130994h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 39.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Soluble calcium-activated nucleotidase 1(CANT1),partial expressed in E.coli

Cant1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7219002	ABM	1.0 ug DNA	EUR 154

Cant1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7219003	ABM	1.0 ug DNA	EUR 154

Cant1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7219004	ABM	1.0 ug DNA	EUR 154

Recombinant Human CANT1 Protein, GST, E.coli-100ug
QP8754-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human CANT1 Protein, GST, E.coli-10ug
QP8754-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human CANT1 Protein, GST, E.coli-1mg
QP8754-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human CANT1 Protein, GST, E.coli-200ug
QP8754-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human CANT1 Protein, GST, E.coli-500ug
QP8754-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human CANT1 Protein, GST, E.coli-50ug
QP8754-ec-50ug	EnQuireBio	50ug	EUR 263

CANT1 Protein Vector (Human) (pPB-C-His)
PV007393	ABM	500 ng	EUR 329

CANT1 Protein Vector (Human) (pPB-N-His)
PV007394	ABM	500 ng	EUR 329

CANT1 Protein Vector (Human) (pPM-C-HA)
PV007395	ABM	500 ng	EUR 329

CANT1 Protein Vector (Human) (pPM-C-His)
PV007396	ABM	500 ng	EUR 329

CANT1 Protein Vector (Rat) (pPB-C-His)
PV257378	ABM	500 ng	EUR 603

CANT1 Protein Vector (Rat) (pPB-N-His)
PV257379	ABM	500 ng	EUR 603

CANT1 Protein Vector (Rat) (pPM-C-HA)
PV257380	ABM	500 ng	EUR 603

CANT1 Protein Vector (Rat) (pPM-C-His)
PV257381	ABM	500 ng	EUR 603

CANT1 Protein Vector (Mouse) (pPB-C-His)
PV161326	ABM	500 ng	EUR 603

CANT1 Protein Vector (Mouse) (pPB-N-His)
PV161327	ABM	500 ng	EUR 603

CANT1 Protein Vector (Mouse) (pPM-C-HA)
PV161328	ABM	500 ng	EUR 603

CANT1 Protein Vector (Mouse) (pPM-C-His)
PV161329	ABM	500 ng	EUR 603

CANT1 Protein Vector (Mouse) (pPB-C-His)
PV161330	ABM	500 ng	EUR 603

CANT1 Protein Vector (Mouse) (pPB-N-His)
PV161331	ABM	500 ng	EUR 603

CANT1 Protein Vector (Mouse) (pPM-C-HA)
PV161332	ABM	500 ng	EUR 603

CANT1 Protein Vector (Mouse) (pPM-C-His)
PV161333	ABM	500 ng	EUR 603

CANT1 Protein Vector (Mouse) (pPB-C-His)
PV161334	ABM	500 ng	EUR 603

CANT1 Protein Vector (Mouse) (pPB-N-His)
PV161335	ABM	500 ng	EUR 603

CANT1 Protein Vector (Mouse) (pPM-C-HA)
PV161336	ABM	500 ng	EUR 603

CANT1 Protein Vector (Mouse) (pPM-C-His)
PV161337	ABM	500 ng	EUR 603

Cant1 3'UTR Luciferase Stable Cell Line
TU201622	ABM	1.0 ml	Ask for price

Cant1 3'UTR GFP Stable Cell Line
TU153090	ABM	1.0 ml	Ask for price

CANT1 3'UTR Luciferase Stable Cell Line
TU003442	ABM	1.0 ml	EUR 1521

CANT1 Rabbit Polyclonal Antibody