CCAR1 Rabbit Polyclonal Antibody
 CCAR1 Rabbit pAb |
|
A6334-100ul |
Abclonal |
100 ul |
EUR 308 |
CCAR1 Rabbit pAb |
|
A6334-200ul |
Abclonal |
200 ul |
EUR 459 |
CCAR1 Rabbit pAb |
|
A6334-20ul |
Abclonal |
20 ul |
EUR 183 |
CCAR1 Rabbit pAb |
|
A6334-50ul |
Abclonal |
50 ul |
EUR 223 |
CCAR1 Rabbit pAb |
|
A13595-100ul |
Abclonal |
100 ul |
EUR 308 |
CCAR1 Rabbit pAb |
|
A13595-200ul |
Abclonal |
200 ul |
EUR 459 |
CCAR1 Rabbit pAb |
|
A13595-20ul |
Abclonal |
20 ul |
EUR 183 |
CCAR1 Rabbit pAb |
|
A13595-50ul |
Abclonal |
50 ul |
EUR 223 |
 CCAR1 Antibody |
|
36417-100ul |
SAB |
100ul |
EUR 252 |
 CCAR1 antibody |
|
38833-100ul |
SAB |
100ul |
EUR 252 |
CCAR1 Antibody |
|
DF2281 |
Affbiotech |
200ul |
EUR 304 |
|
Description: CCAR1 antibody detects endogenous levels of total CCAR1. |
CCAR1 Antibody |
|
1-CSB-PA816898ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
CCAR1 Antibody |
|
1-CSB-PA816898ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
CCAR1 Antibody |
|
1-CSB-PA138742 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
 Polyclonal Goat Anti-CCAR1 Antibody |
|
AMM04927G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CCAR1 . This antibody is tested and proven to work in the following applications: |
 CCAR1 Conjugated Antibody |
|
C36417 |
SAB |
100ul |
EUR 397 |
 Anti-CCAR1 antibody |
|
STJ191663 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CCAR1 |
 CCAR1 siRNA |
|
20-abx910451 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCAR1 siRNA |
|
20-abx910452 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CCAR1 Blocking Peptide |
|
DF2281-BP |
Affbiotech |
1mg |
EUR 195 |
 CCAR1 cloning plasmid |
|
CSB-CL816898HU-10ug |
Cusabio |
10ug |
EUR 1225 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3453
- Sequence: atggctcaatttggaggacagaagaatccgccatgggctactcagtttacagccactgcagtatcacagccagctgcactgggtgttcaacagccatcactccttggagcatctcctaccatttatacacagcaaactgcattggcagcagcaggccttaccacacaaactccag
- Show more
|
|
Description: A cloning plasmid for the CCAR1 gene. |
 Mouse CCAR1 shRNA Plasmid |
|
20-abx976183 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CCAR1 shRNA Plasmid |
|
20-abx960886 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 (pORF)) Ccar1 ORF Vector (Mouse) (pORF) |
|
ORF040496 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) CCAR1 ORF Vector (Human) (pORF) |
|
ORF012586 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Ccar1 ORF Vector (Rat) (pORF) |
|
ORF064449 |
ABM |
1.0 ug DNA |
EUR 506 |
) CCAR1 sgRNA CRISPR Lentivector set (Human) |
|
K0372301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ccar1 sgRNA CRISPR Lentivector set (Rat) |
|
K6317401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ccar1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4825101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 ELISA kit) Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit |
|
E04C1426-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit |
|
E04C1426-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit |
|
E04C1426-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
|
abx146298-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
|
20-abx004842 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
|
20-abx321539 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
|
20-abx321564 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
|
abx431934-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
 Antibody) Cell Division Cycle and Apoptosis Regulator 1 (CCAR1) Antibody |
|
20-abx212846 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
|
20-abx225077 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
 (Target 1)) CCAR1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0372302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CCAR1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0372303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CCAR1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0372304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6317402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6317403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6317404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4825102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4825103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4825104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CCAR1 Protein Vector (Human) (pPB-C-His) |
|
PV050341 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) CCAR1 Protein Vector (Human) (pPB-N-His) |
|
PV050342 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) CCAR1 Protein Vector (Human) (pPM-C-HA) |
|
PV050343 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) CCAR1 Protein Vector (Human) (pPM-C-His) |
|
PV050344 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) CCAR1 Protein Vector (Rat) (pPB-C-His) |
|
PV257794 |
ABM |
500 ng |
EUR 1191 |
 (pPB-N-His)) CCAR1 Protein Vector (Rat) (pPB-N-His) |
|
PV257795 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-HA)) CCAR1 Protein Vector (Rat) (pPM-C-HA) |
|
PV257796 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-His)) CCAR1 Protein Vector (Rat) (pPM-C-His) |
|
PV257797 |
ABM |
500 ng |
EUR 1191 |
 (pPB-C-His)) CCAR1 Protein Vector (Mouse) (pPB-C-His) |
|
PV161982 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) CCAR1 Protein Vector (Mouse) (pPB-N-His) |
|
PV161983 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) CCAR1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV161984 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) CCAR1 Protein Vector (Mouse) (pPM-C-His) |
|
PV161985 |
ABM |
500 ng |
EUR 1065 |
 Ccar1 3'UTR Luciferase Stable Cell Line |
|
TU201733 |
ABM |
1.0 ml |
Ask for price |
 Ccar1 3'UTR GFP Stable Cell Line |
|
TU153213 |
ABM |
1.0 ml |
Ask for price |
 CCAR1 3'UTR Luciferase Stable Cell Line |
|
TU003579 |
ABM |
1.0 ml |
EUR 1394 |
Ccar1 3'UTR Luciferase Stable Cell Line |
|
TU103213 |
ABM |
1.0 ml |
Ask for price |
 CCAR1 3'UTR GFP Stable Cell Line |
|
TU053579 |
ABM |
1.0 ml |
EUR 1394 |
Ccar1 3'UTR GFP Stable Cell Line |
|
TU251733 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CCAR1 Rabbit Polyclonal Antibody
)
)
