CCAR1 Rabbit Polyclonal Antibody

CCAR1 Rabbit Polyclonal Antibody

Rabbit Anti Human Ccar1 Polyclonal Antibody

CPBT-66492RH 0.1 mg
EUR 944

CCAR1 Rabbit pAb

A6334-100ul 100 ul
EUR 308

CCAR1 Rabbit pAb

A6334-200ul 200 ul
EUR 459

CCAR1 Rabbit pAb

A6334-20ul 20 ul
EUR 183

CCAR1 Rabbit pAb

A6334-50ul 50 ul
EUR 223

CCAR1 Rabbit pAb

A13595-100ul 100 ul
EUR 308

CCAR1 Rabbit pAb

A13595-200ul 200 ul
EUR 459

CCAR1 Rabbit pAb

A13595-20ul 20 ul
EUR 183

CCAR1 Rabbit pAb

A13595-50ul 50 ul
EUR 223

CCAR1 Antibody

ABD2281 100 ug
EUR 438

CCAR1 Antibody

36417-100ul 100ul
EUR 252

CCAR1 antibody

38833-100ul 100ul
EUR 252

CCAR1 Antibody

DF2281 200ul
EUR 304
Description: CCAR1 antibody detects endogenous levels of total CCAR1.

CCAR1 Antibody

1-CSB-PA816898ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CCAR1 Antibody

1-CSB-PA816898ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

CCAR1 Antibody

1-CSB-PA138742
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Polyclonal Goat Anti-CCAR1 Antibody

AMM04927G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CCAR1 . This antibody is tested and proven to work in the following applications:

CCAR1 Conjugated Antibody

C36417 100ul
EUR 397

Anti-CCAR1 antibody

STJ72101 100 µg
EUR 359

Anti-CCAR1 antibody

STJ28256 100 µl
EUR 277

Anti-CCAR1 Antibody

STJ500384 100 µg
EUR 476

Anti-CCAR1 antibody

STJ115556 100 µl
EUR 277

Anti-CCAR1 antibody

STJ191663 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCAR1

CCAR1 siRNA

20-abx910451
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCAR1 siRNA

20-abx910452
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-CCAR1 Antibody (Biotin)

STJ500385 100 µg
EUR 586

Anti-CCAR1 Antibody (FITC)

STJ500386 100 µg
EUR 586

CCAR1 Blocking Peptide

DF2281-BP 1mg
EUR 195

CCAR1 cloning plasmid

CSB-CL816898HU-10ug 10ug
EUR 1225
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3453
  • Sequence: atggctcaatttggaggacagaagaatccgccatgggctactcagtttacagccactgcagtatcacagccagctgcactgggtgttcaacagccatcactccttggagcatctcctaccatttatacacagcaaactgcattggcagcagcaggccttaccacacaaactccag
  • Show more
Description: A cloning plasmid for the CCAR1 gene.

Mouse CCAR1 shRNA Plasmid

20-abx976183
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCAR1 ELISA KIT

ELI-24046h 96 Tests
EUR 824

CCAR1 ELISA KIT|Human

EF004736 96 Tests
EUR 689

Mouse Ccar1 ELISA KIT

ELI-50214m 96 Tests
EUR 865

Human CCAR1 shRNA Plasmid

20-abx960886
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Ccar1 ORF Vector (Mouse) (pORF)

ORF040496 1.0 ug DNA
EUR 506

CCAR1 ORF Vector (Human) (pORF)

ORF012586 1.0 ug DNA
EUR 354

Ccar1 ORF Vector (Rat) (pORF)

ORF064449 1.0 ug DNA
EUR 506

CCAR1 sgRNA CRISPR Lentivector set (Human)

K0372301 3 x 1.0 ug
EUR 339

Ccar1 sgRNA CRISPR Lentivector set (Rat)

K6317401 3 x 1.0 ug
EUR 339

Ccar1 sgRNA CRISPR Lentivector set (Mouse)

K4825101 3 x 1.0 ug
EUR 339

Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E04C1426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E04C1426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E04C1426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody

abx146298-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody

20-abx004842
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody

20-abx321539
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody

20-abx321564
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody

abx431934-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Cell Division Cycle and Apoptosis Regulator 1 (CCAR1) Antibody

20-abx212846
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody

20-abx225077
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CCAR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0372302 1.0 ug DNA
EUR 154

CCAR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0372303 1.0 ug DNA
EUR 154

CCAR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0372304 1.0 ug DNA
EUR 154

Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6317402 1.0 ug DNA
EUR 154

Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6317403 1.0 ug DNA
EUR 154

Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6317404 1.0 ug DNA
EUR 154

Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4825102 1.0 ug DNA
EUR 154

Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4825103 1.0 ug DNA
EUR 154

Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4825104 1.0 ug DNA
EUR 154

CCAR1 Protein Vector (Human) (pPB-C-His)

PV050341 500 ng
EUR 481

CCAR1 Protein Vector (Human) (pPB-N-His)

PV050342 500 ng
EUR 481

CCAR1 Protein Vector (Human) (pPM-C-HA)

PV050343 500 ng
EUR 481

CCAR1 Protein Vector (Human) (pPM-C-His)

PV050344 500 ng
EUR 481

CCAR1 Protein Vector (Rat) (pPB-C-His)

PV257794 500 ng
EUR 1191

CCAR1 Protein Vector (Rat) (pPB-N-His)

PV257795 500 ng
EUR 1191

CCAR1 Protein Vector (Rat) (pPM-C-HA)

PV257796 500 ng
EUR 1191

CCAR1 Protein Vector (Rat) (pPM-C-His)

PV257797 500 ng
EUR 1191

CCAR1 Protein Vector (Mouse) (pPB-C-His)

PV161982 500 ng
EUR 1065

CCAR1 Protein Vector (Mouse) (pPB-N-His)

PV161983 500 ng
EUR 1065

CCAR1 Protein Vector (Mouse) (pPM-C-HA)

PV161984 500 ng
EUR 1065

CCAR1 Protein Vector (Mouse) (pPM-C-His)

PV161985 500 ng
EUR 1065

Ccar1 3'UTR Luciferase Stable Cell Line

TU201733 1.0 ml Ask for price

Ccar1 3'UTR GFP Stable Cell Line

TU153213 1.0 ml Ask for price

CCAR1 3'UTR Luciferase Stable Cell Line

TU003579 1.0 ml
EUR 1394

Ccar1 3'UTR Luciferase Stable Cell Line

TU103213 1.0 ml Ask for price

CCAR1 3'UTR GFP Stable Cell Line

TU053579 1.0 ml
EUR 1394

Ccar1 3'UTR GFP Stable Cell Line

TU251733 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CCAR1 Rabbit Polyclonal Antibody