CCAR1 Rabbit Polyclonal Antibody
 CCAR1 Rabbit pAb |
|
A13595-100ul |
Abclonal |
100 ul |
EUR 308 |
CCAR1 Rabbit pAb |
|
A13595-200ul |
Abclonal |
200 ul |
EUR 459 |
CCAR1 Rabbit pAb |
|
A13595-20ul |
Abclonal |
20 ul |
EUR 183 |
CCAR1 Rabbit pAb |
|
A13595-50ul |
Abclonal |
50 ul |
EUR 223 |
CCAR1 Rabbit pAb |
|
A6334-100ul |
Abclonal |
100 ul |
EUR 308 |
CCAR1 Rabbit pAb |
|
A6334-200ul |
Abclonal |
200 ul |
EUR 459 |
CCAR1 Rabbit pAb |
|
A6334-20ul |
Abclonal |
20 ul |
EUR 183 |
CCAR1 Rabbit pAb |
|
A6334-50ul |
Abclonal |
50 ul |
EUR 223 |
 CCAR1 Antibody |
|
36417-100ul |
SAB |
100ul |
EUR 252 |
 CCAR1 antibody |
|
38833-100ul |
SAB |
100ul |
EUR 252 |
CCAR1 Antibody |
|
1-CSB-PA138742 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
CCAR1 Antibody |
|
1-CSB-PA816898ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
CCAR1 Antibody |
|
1-CSB-PA816898ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against CCAR1. Recognizes CCAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
CCAR1 Antibody |
|
DF2281 |
Affbiotech |
200ul |
EUR 304 |
|
Description: CCAR1 antibody detects endogenous levels of total CCAR1. |
 Polyclonal Goat Anti-CCAR1 Antibody |
|
AMM04927G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CCAR1 . This antibody is tested and proven to work in the following applications: |
 CCAR1 Conjugated Antibody |
|
C36417 |
SAB |
100ul |
EUR 397 |
 Anti-CCAR1 antibody |
|
STJ191663 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CCAR1 |
 CCAR1 siRNA |
|
20-abx910451 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCAR1 siRNA |
|
20-abx910452 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CCAR1 Blocking Peptide |
|
DF2281-BP |
Affbiotech |
1mg |
EUR 195 |
 CCAR1 cloning plasmid |
|
CSB-CL816898HU-10ug |
Cusabio |
10ug |
EUR 1225 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3453
- Sequence: atggctcaatttggaggacagaagaatccgccatgggctactcagtttacagccactgcagtatcacagccagctgcactgggtgttcaacagccatcactccttggagcatctcctaccatttatacacagcaaactgcattggcagcagcaggccttaccacacaaactccag
- Show more
|
|
Description: A cloning plasmid for the CCAR1 gene. |
 Mouse CCAR1 shRNA Plasmid |
|
20-abx976183 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CCAR1 shRNA Plasmid |
|
20-abx960886 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 (pORF)) Ccar1 ORF Vector (Rat) (pORF) |
|
ORF064449 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) CCAR1 ORF Vector (Human) (pORF) |
|
ORF012586 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Ccar1 ORF Vector (Mouse) (pORF) |
|
ORF040496 |
ABM |
1.0 ug DNA |
EUR 506 |
) CCAR1 sgRNA CRISPR Lentivector set (Human) |
|
K0372301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ccar1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4825101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ccar1 sgRNA CRISPR Lentivector set (Rat) |
|
K6317401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 ELISA kit) Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit |
|
E04C1426-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit |
|
E04C1426-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit |
|
E04C1426-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
|
20-abx004842 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 Antibody) Cell Division Cycle and Apoptosis Regulator 1 (CCAR1) Antibody |
|
20-abx212846 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
|
abx146298-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
|
20-abx321539 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
|
20-abx321564 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
|
abx431934-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Cell Division Cycle And Apoptosis Regulator 1 (CCAR1) Antibody |
|
20-abx225077 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
 (Target 1)) CCAR1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0372302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CCAR1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0372303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CCAR1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0372304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4825102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4825103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ccar1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4825104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6317402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6317403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ccar1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6317404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CCAR1 Protein Vector (Mouse) (pPB-C-His) |
|
PV161982 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) CCAR1 Protein Vector (Mouse) (pPB-N-His) |
|
PV161983 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) CCAR1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV161984 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) CCAR1 Protein Vector (Mouse) (pPM-C-His) |
|
PV161985 |
ABM |
500 ng |
EUR 1065 |
 (pPB-C-His)) CCAR1 Protein Vector (Rat) (pPB-C-His) |
|
PV257794 |
ABM |
500 ng |
EUR 1191 |
 (pPB-N-His)) CCAR1 Protein Vector (Rat) (pPB-N-His) |
|
PV257795 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-HA)) CCAR1 Protein Vector (Rat) (pPM-C-HA) |
|
PV257796 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-His)) CCAR1 Protein Vector (Rat) (pPM-C-His) |
|
PV257797 |
ABM |
500 ng |
EUR 1191 |
 (pPB-C-His)) CCAR1 Protein Vector (Human) (pPB-C-His) |
|
PV050341 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) CCAR1 Protein Vector (Human) (pPB-N-His) |
|
PV050342 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) CCAR1 Protein Vector (Human) (pPM-C-HA) |
|
PV050343 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) CCAR1 Protein Vector (Human) (pPM-C-His) |
|
PV050344 |
ABM |
500 ng |
EUR 481 |
 Ccar1 3'UTR GFP Stable Cell Line |
|
TU153213 |
ABM |
1.0 ml |
Ask for price |
 Ccar1 3'UTR Luciferase Stable Cell Line |
|
TU103213 |
ABM |
1.0 ml |
Ask for price |
Ccar1 3'UTR Luciferase Stable Cell Line |
|
TU201733 |
ABM |
1.0 ml |
Ask for price |
Ccar1 3'UTR GFP Stable Cell Line |
|
TU251733 |
ABM |
1.0 ml |
Ask for price |
 CCAR1 3'UTR GFP Stable Cell Line |
|
TU053579 |
ABM |
1.0 ml |
EUR 1394 |
 CCAR1 3'UTR Luciferase Stable Cell Line |
|
TU003579 |
ABM |
1.0 ml |
EUR 1394 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
CCAR1 Rabbit Polyclonal Antibody
)
)
