CCBE1 Rabbit Polyclonal Antibody

CCBE1 Rabbit Polyclonal Antibody

CCBE1 Polyclonal Antibody

ABP58005-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of CCBE1 from Human. This CCBE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200

CCBE1 antibody

70R-51193 100 ul
EUR 244
Description: Purified Polyclonal CCBE1 antibody

CCBE1 antibody

70R-4000 50 ug
EUR 467
Description: Rabbit polyclonal CCBE1 antibody raised against the middle region of CCBE1

Ccbe1 antibody

70R-9189 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Ccbe1 antibody

CCBE1 Antibody

ABD10092 100 ug
EUR 438

CCBE1 Antibody

44510-100ul 100ul
EUR 252

CCBE1 Antibody

44510-50ul 50ul
EUR 187

CCBE1 Antibody

DF10092 200ul
EUR 304
Description: CCBE1 Antibody detects endogenous levels of total CCBE1.

Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit

DLR-CCBE1-Hu-48T 48T
EUR 517
  • Should the Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit

DLR-CCBE1-Hu-96T 96T
EUR 673
  • Should the Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit

RD-CCBE1-Hu-48Tests 48 Tests
EUR 521

Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit

RD-CCBE1-Hu-96Tests 96 Tests
EUR 723

Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit

RDR-CCBE1-Hu-48Tests 48 Tests
EUR 544

Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit

RDR-CCBE1-Hu-96Tests 96 Tests
EUR 756

Polyclonal Ccbe1 antibody - C-terminal region

APR01142G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ccbe1 - C-terminal region. This antibody is tested and proven to work in the following applications:

CCBE1 Conjugated Antibody

C44510 100ul
EUR 397

Anti-CCBE1 antibody

PAab01339 100 ug
EUR 355

Anti-CCBE1 antibody

STJ191834 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCBE1

CCBE1 siRNA

20-abx910455
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCBE1 siRNA

20-abx910456
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CCBE1

YF-PA22396 50 ug
EUR 363
Description: Mouse polyclonal to CCBE1

anti-CCBE1

YF-PA22397 100 ul
EUR 403
Description: Rabbit polyclonal to CCBE1

anti-CCBE1

YF-PA22398 100 ug
EUR 403
Description: Rabbit polyclonal to CCBE1

CCBE1 Blocking Peptide

20-abx064068
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CCBE1 Blocking Peptide

33R-7221 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCBE1 antibody, catalog no. 70R-4000

Ccbe1 Blocking Peptide

33R-7915 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Ccbe1 antibody, catalog no. 70R-9189

CCBE1 Blocking Peptide

DF10092-BP 1mg
EUR 195

CCBE1 cloning plasmid

CSB-CL747637HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atggtgaaagccggaacttgctgtgccacatgcaaggagttctaccagatgaagcagaccgtgctgcagctgaagcaaaagattgctctgctccccaacaatgcagctgacctgggcaagtatatcactggtgacaaggtgctggcctcaaacacctaccttccaggacctcctgg
  • Show more
Description: A cloning plasmid for the CCBE1 gene.

Mouse CCBE1 shRNA Plasmid

20-abx983470
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCBE1 shRNA Plasmid

20-abx965517
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCBE1 ELISA KIT|Human

EF008431 96 Tests
EUR 689

Human CCBE1 ELISA KIT

ELI-33186h 96 Tests
EUR 824

Mouse Ccbe1 ELISA KIT

ELI-34268m 96 Tests
EUR 865

CCBE1 Recombinant Protein (Human)

RP005782 100 ug Ask for price

pCMV-SPORT6-CCBE1 Plasmid

PVT16889 2 ug
EUR 325

CCBE1 Recombinant Protein (Mouse)

RP121487 100 ug Ask for price

CCBE1 ORF Vector (Human) (pORF)

ORF001928 1.0 ug DNA
EUR 95

Ccbe1 ORF Vector (Mouse) (pORF)

ORF040497 1.0 ug DNA
EUR 506

CCBE1 sgRNA CRISPR Lentivector set (Human)

K0372401 3 x 1.0 ug
EUR 339

Ccbe1 sgRNA CRISPR Lentivector set (Mouse)

K4287001 3 x 1.0 ug
EUR 339

CCBE1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0372402 1.0 ug DNA
EUR 154

CCBE1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0372403 1.0 ug DNA
EUR 154

CCBE1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0372404 1.0 ug DNA
EUR 154

Ccbe1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4287002 1.0 ug DNA
EUR 154

Ccbe1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4287003 1.0 ug DNA
EUR 154

Ccbe1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4287004 1.0 ug DNA
EUR 154

CCBE1 Protein Vector (Human) (pPB-C-His)

PV007709 500 ng
EUR 329

CCBE1 Protein Vector (Human) (pPB-N-His)

PV007710 500 ng
EUR 329

CCBE1 Protein Vector (Human) (pPM-C-HA)

PV007711 500 ng
EUR 329

CCBE1 Protein Vector (Human) (pPM-C-His)

PV007712 500 ng
EUR 329

CCBE1 Protein Vector (Mouse) (pPB-C-His)

PV161986 500 ng
EUR 603

CCBE1 Protein Vector (Mouse) (pPB-N-His)

PV161987 500 ng
EUR 603

CCBE1 Protein Vector (Mouse) (pPM-C-HA)

PV161988 500 ng
EUR 603

CCBE1 Protein Vector (Mouse) (pPM-C-His)

PV161989 500 ng
EUR 603

Ccbe1 3'UTR Luciferase Stable Cell Line

TU201734 1.0 ml Ask for price

Ccbe1 3'UTR GFP Stable Cell Line

TU153214 1.0 ml Ask for price

CCBE1 3'UTR Luciferase Stable Cell Line

TU003580 1.0 ml
EUR 1521

Ccbe1 3'UTR Luciferase Stable Cell Line

TU103214 1.0 ml Ask for price

CCBE1 3'UTR GFP Stable Cell Line

TU053580 1.0 ml
EUR 1521

Ccbe1 3'UTR GFP Stable Cell Line

TU251734 1.0 ml Ask for price

Rabbit Collagen and calcium binding EGF domain containing protein 1(CCBE1) ELISA kit

E04C1427-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Collagen and calcium binding EGF domain containing protein 1(CCBE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Collagen and calcium binding EGF domain containing protein 1(CCBE1) ELISA kit

E04C1427-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Collagen and calcium binding EGF domain containing protein 1(CCBE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Collagen and calcium binding EGF domain containing protein 1(CCBE1) ELISA kit

E04C1427-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Collagen and calcium binding EGF domain containing protein 1(CCBE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CCBE1 Rabbit Polyclonal Antibody