CCNI Rabbit Polyclonal Antibody

CCNI Rabbit Polyclonal Antibody

CCNI Polyclonal Antibody

ES10508-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCNI from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCNI Rabbit pAb

A17623-100ul 100 ul
EUR 308

CCNI Rabbit pAb

A17623-200ul 200 ul
EUR 459

CCNI Rabbit pAb

A17623-20ul 20 ul
EUR 183

CCNI Rabbit pAb

A17623-50ul 50 ul
EUR 223

CCNI antibody

70R-16239 50 ul
EUR 435
Description: Rabbit polyclonal CCNI antibody

CCNI Antibody

44457-100ul 100ul
EUR 252

CCNI Antibody

44457-50ul 50ul
EUR 187

CCNI Antibody

1-CSB-PA004823GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CCNI. Recognizes CCNI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IF

CCNI Antibody

DF10025 200ul
EUR 304
Description: CCNI Antibody detects endogenous levels of total CCNI.

CCNI Antibody

ABD10025 100 ug
EUR 438

CCNI Conjugated Antibody

C44457 100ul
EUR 397

Anti-CCNI antibody

STJ119685 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin shows the highest similarity with cyclin G. The transcript of this gene was found to be expressed constantly during cell cycle progression. [provided by RefSeq, Jan 2017]

Anti-CCNI antibody

STJ191666 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCNI

CCNI siRNA

20-abx910841
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCNI siRNA

20-abx910842
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-CCNI

PVT18373 2 ug
EUR 231

Rabbit Cyclin I(CCNI) ELISA kit

E04C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin I(CCNI) ELISA kit

E04C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin I(CCNI) ELISA kit

E04C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cyclin-I (CCNI) Antibody

20-abx149018
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CCNI Blocking Peptide

DF10025-BP 1mg
EUR 195

CCNI cloning plasmid

CSB-CL623898HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atgaagtttccagggcctttggaaaaccagagattgtctttcctgttggaaaaggcaatcactagggaagcacagatgtggaaagtgaatgtgcggaaaatgccttcaaatcagaatgtttctccatcccagagagatgaagtaattcaatggctggccaaactcaagtaccaat
  • Show more
Description: A cloning plasmid for the CCNI gene.

Human Cyclin-I (CCNI) Antibody

31021-05111 150 ug
EUR 261

Human CCNI shRNA Plasmid

20-abx957500
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCNI shRNA Plasmid

20-abx969531
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCNI Recombinant Protein (Human)

RP006202 100 ug Ask for price

CCNI Recombinant Protein (Rat)

RP193733 100 ug Ask for price

CCNI Recombinant Protein (Mouse)

RP122195 100 ug Ask for price

Human Cyclin-I (CCNI) Antibody (Biotin Conjugate)

31021-05121 150 ug
EUR 369

Ccni ORF Vector (Rat) (pORF)

ORF064579 1.0 ug DNA
EUR 506

CCNI ORF Vector (Human) (pORF)

ORF002068 1.0 ug DNA
EUR 95

Ccni ORF Vector (Mouse) (pORF)

ORF040733 1.0 ug DNA
EUR 506

Human Cyclin-I (CCNI) AssayLite Antibody (FITC Conjugate)

31021-05141 150 ug
EUR 428

Human Cyclin-I (CCNI) AssayLite Antibody (RPE Conjugate)

31021-05151 150 ug
EUR 428

Human Cyclin-I (CCNI) AssayLite Antibody (APC Conjugate)

31021-05161 150 ug
EUR 428

Human Cyclin-I (CCNI) AssayLite Antibody (PerCP Conjugate)

31021-05171 150 ug
EUR 471

Rat Cyclin I(CCNI) ELISA kit

E02C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin I(CCNI) ELISA kit

E02C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin I(CCNI) ELISA kit

E02C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cyclin I(CCNI) ELISA kit

E06C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cyclin I(CCNI) ELISA kit

E06C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cyclin I(CCNI) ELISA kit

E06C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin I(CCNI) ELISA kit

E03C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin I(CCNI) ELISA kit

E03C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin I(CCNI) ELISA kit

E03C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin I(CCNI) ELISA kit

E01C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin I(CCNI) ELISA kit

E01C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin I(CCNI) ELISA kit

E01C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cyclin I(CCNI) ELISA kit

E07C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cyclin I(CCNI) ELISA kit

E07C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cyclin I(CCNI) ELISA kit

E07C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin I (CCNI) ELISA Kit

abx259517-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Monkey Cyclin I(CCNI) ELISA kit

E09C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cyclin I(CCNI) ELISA kit

E09C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cyclin I(CCNI) ELISA kit

E09C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cyclin I(CCNI) ELISA kit

E08C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cyclin I(CCNI) ELISA kit

E08C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cyclin I(CCNI) ELISA kit

E08C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin- I, CCNI ELISA KIT

ELI-10451h 96 Tests
EUR 824

Mouse Cyclin- I, Ccni ELISA KIT

ELI-25442m 96 Tests
EUR 865

CCNI sgRNA CRISPR Lentivector set (Human)

K0393201 3 x 1.0 ug
EUR 339

Ccni sgRNA CRISPR Lentivector set (Mouse)

K4975701 3 x 1.0 ug
EUR 339

Ccni sgRNA CRISPR Lentivector set (Rat)

K6501101 3 x 1.0 ug
EUR 339

CCNI Cyclin-I Human Recombinant Protein

PROTQ14094 Regular: 20ug
EUR 317
Description: CCNI Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 400 amino acids (1-377 a.a) and having a molecular mass of 44.9kDa.;CCNI is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Cyclin I(CCNI)ELISA Kit

QY-E00931 96T
EUR 361

Guinea pig Cyclin I(CCNI) ELISA kit

E05C1161-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cyclin I(CCNI) ELISA kit

E05C1161-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cyclin I(CCNI) ELISA kit

E05C1161-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cyclin I(CCNI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CCNI sgRNA CRISPR Lentivector (Human) (Target 1)

K0393202 1.0 ug DNA
EUR 154

CCNI sgRNA CRISPR Lentivector (Human) (Target 2)

K0393203 1.0 ug DNA
EUR 154

CCNI sgRNA CRISPR Lentivector (Human) (Target 3)

K0393204 1.0 ug DNA
EUR 154

Ccni sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4975702 1.0 ug DNA
EUR 154

Ccni sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4975703 1.0 ug DNA
EUR 154

Ccni sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4975704 1.0 ug DNA
EUR 154

Ccni sgRNA CRISPR Lentivector (Rat) (Target 1)

K6501102 1.0 ug DNA
EUR 154

Ccni sgRNA CRISPR Lentivector (Rat) (Target 2)

K6501103 1.0 ug DNA
EUR 154

Ccni sgRNA CRISPR Lentivector (Rat) (Target 3)

K6501104 1.0 ug DNA
EUR 154

CCNI Protein Vector (Mouse) (pPB-C-His)

PV162930 500 ng
EUR 603

CCNI Protein Vector (Mouse) (pPB-N-His)

PV162931 500 ng
EUR 603

CCNI Protein Vector (Mouse) (pPM-C-HA)

PV162932 500 ng
EUR 603

CCNI Protein Vector (Mouse) (pPM-C-His)

PV162933 500 ng
EUR 603

CCNI Protein Vector (Rat) (pPB-C-His)

PV258314 500 ng
EUR 603

CCNI Protein Vector (Rat) (pPB-N-His)

PV258315 500 ng
EUR 603

CCNI Protein Vector (Rat) (pPM-C-HA)

PV258316 500 ng
EUR 603

CCNI Protein Vector (Rat) (pPM-C-His)

PV258317 500 ng
EUR 603

CCNI Protein Vector (Human) (pPB-C-His)

PV008269 500 ng
EUR 329

CCNI Protein Vector (Human) (pPB-N-His)

PV008270 500 ng
EUR 329

CCNI Protein Vector (Human) (pPM-C-HA)

PV008271 500 ng
EUR 329

CCNI Protein Vector (Human) (pPM-C-His)

PV008272 500 ng
EUR 329

Recombinant Human CCNI Protein, His, E.coli-1mg

QP11298-1mg 1mg
EUR 2757

Recombinant Human CCNI Protein, His, E.coli-20ug

QP11298-20ug 20ug
EUR 201

Recombinant Human CCNI Protein, His, E.coli-5ug

QP11298-5ug 5ug
EUR 155

Ccni 3'UTR GFP Stable Cell Line

TU153409 1.0 ml Ask for price

Ccni 3'UTR Luciferase Stable Cell Line

TU103409 1.0 ml Ask for price

Ccni 3'UTR Luciferase Stable Cell Line

TU201895 1.0 ml Ask for price

Ccni 3'UTR GFP Stable Cell Line

TU251895 1.0 ml Ask for price

CCNI 3'UTR GFP Stable Cell Line

TU053797 1.0 ml
EUR 1394

CCNI 3'UTR Luciferase Stable Cell Line

TU003797 1.0 ml
EUR 1394

Human Cyclin-I (CCNI) AssayLite Antibody (FITC, RPE, APC, PerCP Conjugate)

31021-05181 1 x 75 ug, 3 x 30 ug
EUR 585

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

CCNI Rabbit Polyclonal Antibody