CCNL2 Rabbit Polyclonal Antibody

CCNL2 Rabbit Polyclonal Antibody

CCNL2 Polyclonal Antibody

ABP58022-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CCNL2 protein at amino acid sequence of 400-480
  • Applications tips:
Description: A polyclonal antibody for detection of CCNL2 from Human, Mouse, Rat. This CCNL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCNL2 protein at amino acid sequence of 400-480

CCNL2 Polyclonal Antibody

ES10510-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CCNL2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCNL2 Polyclonal Antibody

ES10510-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCNL2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCNL2 Rabbit pAb

A14938-100ul 100 ul
EUR 308

CCNL2 Rabbit pAb

A14938-200ul 200 ul
EUR 459

CCNL2 Rabbit pAb

A14938-20ul 20 ul
EUR 183

CCNL2 Rabbit pAb

A14938-50ul 50 ul
EUR 223

CCNL2 antibody

70R-16242 50 ul
EUR 435
Description: Rabbit polyclonal CCNL2 antibody

CCNL2 Antibody

44709-100ul 100ul
EUR 252

CCNL2 Antibody

44709-50ul 50ul
EUR 187

CCNL2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CCNL2. Recognizes CCNL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

CCNL2 Antibody

DF2287 200ul
EUR 304
Description: CCNL2 antibody detects endogenous levels of total CCNL2.

CCNL2 antibody

70R-8972 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CCNL2 antibody

CCNL2 Antibody

ABD2287 100 ug
EUR 438

Ccnl2/ Rat Ccnl2 ELISA Kit

ELI-50829r 96 Tests
EUR 886

R Ccnl2 Antibody

abx034862-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

R Ccnl2 Antibody

abx034862-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CCNL2 Conjugated Antibody

C44709 100ul
EUR 397

Anti-CCNL2 antibody

STJ117137 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the cyclin family. Through its interaction with several proteins, such as RNA polymerase II, splicing factors, and cyclin-dependent kinases, this protein functions as a regulator of the pre-mRNA splicing process, as well as in inducing apoptosis by modulating the expression of apoptotic and antiapoptotic proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.

Anti-CCNL2 antibody

STJ191668 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCNL2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Cyclin L2(CCNL2) ELISA kit

E04C1168-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin L2(CCNL2) ELISA kit

E04C1168-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin L2(CCNL2) ELISA kit

E04C1168-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cyclin-L2 (CCNL2) Antibody

abx026781-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cyclin-L2 (CCNL2) Antibody

abx026781-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cyclin-L2 (CCNL2) Antibody

abx038286-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cyclin-L2 (CCNL2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CCNL2 Blocking Peptide

33R-9094 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCNL2 antibody, catalog no. 70R-8972

CCNL2 Blocking Peptide

DF2287-BP 1mg
EUR 195

CCNL2 cloning plasmid

CSB-CL847223HU-10ug 10ug
EUR 300
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 681
  • Sequence: atggcggcggcggcggcggcggctggtgctgcagggtcggcagctcccgcggcagcggccggcgccccgggatctgggggcgcaccctcagggtcgcagggggtgctgatcggggacaggctgtactccggggtgctcatcaccttggagaactgcctcctgcctgacgacaagct
  • Show more
Description: A cloning plasmid for the CCNL2 gene.

Rat CCNL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCNL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCNL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pECMV- CCNL2- 3*Flag

PVT10282 2 ug
EUR 337

CCNL2 Recombinant Protein (Human)

RP006220 100 ug Ask for price

CCNL2 Recombinant Protein (Rat)

RP193748 100 ug Ask for price

CCNL2 Recombinant Protein (Mouse)

RP122210 100 ug Ask for price

Ccnl2 ORF Vector (Rat) (pORF)

ORF064584 1.0 ug DNA
EUR 506

CCNL2 ORF Vector (Human) (pORF)

ORF002074 1.0 ug DNA
EUR 95

Ccnl2 ORF Vector (Mouse) (pORF)

ORF040738 1.0 ug DNA
EUR 506

Rat Cyclin L2(CCNL2) ELISA kit

E02C1168-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin L2(CCNL2) ELISA kit

E02C1168-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin L2(CCNL2) ELISA kit

E02C1168-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cyclin L2(CCNL2) ELISA kit

E06C1168-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cyclin L2(CCNL2) ELISA kit

E06C1168-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cyclin L2(CCNL2) ELISA kit

E06C1168-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin L2(CCNL2) ELISA kit

E03C1168-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin L2(CCNL2) ELISA kit

E03C1168-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin L2(CCNL2) ELISA kit

E03C1168-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin L2(CCNL2) ELISA kit

E01C1168-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin L2(CCNL2) ELISA kit

E01C1168-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin L2(CCNL2) ELISA kit

E01C1168-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cyclin L2(CCNL2) ELISA kit

E07C1168-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cyclin L2(CCNL2) ELISA kit

E07C1168-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cyclin L2(CCNL2) ELISA kit

E07C1168-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cyclin L2(CCNL2) ELISA kit

E09C1168-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cyclin L2(CCNL2) ELISA kit

E09C1168-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cyclin L2(CCNL2) ELISA kit

E09C1168-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cyclin L2(CCNL2) ELISA kit

E08C1168-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cyclin L2(CCNL2) ELISA kit

E08C1168-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cyclin L2(CCNL2) ELISA kit

E08C1168-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin- L2, CCNL2 ELISA KIT

ELI-10678h 96 Tests
EUR 824

Mouse Cyclin- L2, Ccnl2 ELISA KIT

ELI-50880m 96 Tests
EUR 865

CCNL2 sgRNA CRISPR Lentivector set (Human)

K0393901 3 x 1.0 ug
EUR 339

Ccnl2 sgRNA CRISPR Lentivector set (Rat)

K6653301 3 x 1.0 ug
EUR 339

Ccnl2 sgRNA CRISPR Lentivector set (Mouse)

K3917001 3 x 1.0 ug
EUR 339

Human Cyclin L2(CCNL2)ELISA Kit

QY-E00927 96T
EUR 361

Guinea pig Cyclin L2(CCNL2) ELISA kit

E05C1168-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cyclin L2(CCNL2) ELISA kit

E05C1168-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cyclin L2(CCNL2) ELISA kit

E05C1168-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cyclin L2(CCNL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CCNL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0393902 1.0 ug DNA
EUR 154

CCNL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0393903 1.0 ug DNA
EUR 154

CCNL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0393904 1.0 ug DNA
EUR 154

Ccnl2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6653302 1.0 ug DNA
EUR 154

Ccnl2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6653303 1.0 ug DNA
EUR 154

Ccnl2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6653304 1.0 ug DNA
EUR 154

Ccnl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3917002 1.0 ug DNA
EUR 154

Ccnl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3917003 1.0 ug DNA
EUR 154

Ccnl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3917004 1.0 ug DNA
EUR 154

CCNL2 Protein Vector (Mouse) (pPB-C-His)

PV162950 500 ng
EUR 603

CCNL2 Protein Vector (Mouse) (pPB-N-His)

PV162951 500 ng
EUR 603

CCNL2 Protein Vector (Mouse) (pPM-C-HA)

PV162952 500 ng
EUR 603

CCNL2 Protein Vector (Mouse) (pPM-C-His)

PV162953 500 ng
EUR 603

CCNL2 Protein Vector (Rat) (pPB-C-His)

PV258334 500 ng
EUR 603

CCNL2 Protein Vector (Rat) (pPB-N-His)

PV258335 500 ng
EUR 603

CCNL2 Protein Vector (Rat) (pPM-C-HA)

PV258336 500 ng
EUR 603

CCNL2 Protein Vector (Rat) (pPM-C-His)

PV258337 500 ng
EUR 603

CCNL2 Protein Vector (Human) (pPB-C-His)

PV008293 500 ng
EUR 329

CCNL2 Protein Vector (Human) (pPB-N-His)

PV008294 500 ng
EUR 329

CCNL2 Protein Vector (Human) (pPM-C-HA)

PV008295 500 ng
EUR 329

CCNL2 Protein Vector (Human) (pPM-C-His)

PV008296 500 ng
EUR 329

Ccnl2 3'UTR GFP Stable Cell Line

TU153414 1.0 ml Ask for price

Ccnl2 3'UTR Luciferase Stable Cell Line

TU103414 1.0 ml Ask for price

Ccnl2 3'UTR Luciferase Stable Cell Line

TU201900 1.0 ml Ask for price

Ccnl2 3'UTR GFP Stable Cell Line

TU251900 1.0 ml Ask for price

CCNL2 3'UTR GFP Stable Cell Line

TU053805 1.0 ml
EUR 2333

CCNL2 3'UTR Luciferase Stable Cell Line

TU003805 1.0 ml
EUR 2333

CCNL2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV679303 1.0 ug DNA
EUR 514

CCNL2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV679307 1.0 ug DNA
EUR 514

CCNL2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV679308 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

CCNL2 Rabbit Polyclonal Antibody