CD27 Rabbit Polyclonal Antibody

CD27 Rabbit Polyclonal Antibody

CD27 Polyclonal Antibody
ABP58051-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human CD27 protein at amino acid sequence of 1-80 Applications tips:
Description: A polyclonal antibody for detection of CD27 from Human. This CD27 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD27 protein at amino acid sequence of 1-80

CD27 Polyclonal Antibody
ABP58051-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human CD27 protein at amino acid sequence of 1-80 Applications tips:
Description: A polyclonal antibody for detection of CD27 from Human. This CD27 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD27 protein at amino acid sequence of 1-80

CD27 Polyclonal Antibody
ABP58051-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human CD27 protein at amino acid sequence of 1-80 Applications tips:
Description: A polyclonal antibody for detection of CD27 from Human. This CD27 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD27 protein at amino acid sequence of 1-80

CD27 Polyclonal Antibody
ES10514-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD27 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CD27 Polyclonal Antibody
ES10514-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD27 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rabbit CD27 antigen(CD27) ELISA kit
E04C1473-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CD27 antigen(CD27) ELISA kit
E04C1473-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CD27 antigen(CD27) ELISA kit
E04C1473-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CD27 Rabbit pAb
A15654-100ul	Abclonal	100 ul	EUR 308

CD27 Rabbit pAb
A15654-200ul	Abclonal	200 ul	EUR 459

CD27 Rabbit pAb
A15654-20ul	Abclonal	20 ul	EUR 183

CD27 Rabbit pAb
A15654-50ul	Abclonal	50 ul	EUR 223

CD27 Rabbit pAb
A1945-100ul	Abclonal	100 ul	EUR 308

CD27 Rabbit pAb
A1945-200ul	Abclonal	200 ul	EUR 459

CD27 Rabbit pAb
A1945-20ul	Abclonal	20 ul	EUR 183

CD27 Rabbit pAb
A1945-50ul	Abclonal	50 ul	EUR 223

CD27 Polyclonal Antibody, HRP Conjugated
A50649	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

CD27 Polyclonal Antibody, FITC Conjugated
A50650	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

CD27 Polyclonal Antibody, Biotin Conjugated
A50651	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

CD27 antibody
70R-16264	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CD27 antibody

CD27 Antibody
32512-100ul	SAB	100ul	EUR 252

CD27 antibody
10R-6372	Fitzgerald	100 ug	EUR 192
Description: Armenian Hamster monoclonal CD27 antibody

CD27 antibody
10R-6373	Fitzgerald	100 ug	EUR 224
Description: Armenian Hamster monoclonal CD27 antibody

CD27 antibody
10R-6374	Fitzgerald	100 ug	EUR 220
Description: Mouse monoclonal CD27 antibody

CD27 antibody
10R-7982	Fitzgerald	100 ug	EUR 489
Description: Armenian Hamster monoclonal CD27 antibody

CD27 antibody
10R-7983	Fitzgerald	100 ug	EUR 489
Description: American Hamster monoclonal CD27 antibody

CD27 Antibody
49854-100ul	SAB	100ul	EUR 333

CD27 Antibody
49854-50ul	SAB	50ul	EUR 239

CD27 Antibody
1-CSB-PA004910GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CD27. Recognizes CD27 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CD27 Antibody
1-CSB-PA08235A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD27. Recognizes CD27 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:50-1:500

CD27 Antibody
1-CSB-PA123791	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD27. Recognizes CD27 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CD27 Antibody
DF6709	Affbiotech	200ul	EUR 304
Description: CD27 Antibody detects endogenous levels of total CD27.

CD27 Antibody
DF2296	Affbiotech	200ul	EUR 304
Description: CD27 antibody detects endogenous levels of total CD27.

CD27 Antibody
1-CSB-PA149291	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD27. Recognizes CD27 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:1000-1:5000, IHC:1:50-1:200

CD27 antibody
70R-9668	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal CD27 antibody

CD27 Antibody
ABD2296	Lifescience Market	100 ug	EUR 438

CD27 Antibody
ABD6709	Lifescience Market	100 ug	EUR 438

CD27
27A-100T	ImmunoStep	100 test	EUR 401

CD27
27F-100T	ImmunoStep	100 test	EUR 323

CD27
27PE-100T	ImmunoStep	100 test	EUR 401

CD27
27PP5.5-100T	ImmunoStep	100 test	EUR 388

CD27
PR27310	Neuromics	5 ug	EUR 191

T-cell Activation Antigen CD27 (CD27) Antibody
abx027573-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

T-cell Activation Antigen CD27 (CD27) Antibody
abx027573-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

T-cell Activation Antigen CD27 (CD27) Antibody
20-abx211067	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

T-cell Activation Antigen CD27 (CD27) Antibody
20-abx211217	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

T-cell Activation Antigen CD27 (CD27) Antibody
20-abx111471	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

T-cell Activation Antigen CD27 (CD27) Antibody
abx146709-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

T-cell Activation Antigen CD27 (CD27) Antibody
abx147085-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

T-cell Activation Antigen CD27 (CD27) Antibody
abx139209-01mg	Abbexa	0.1 mg	EUR 356
Shipped within 5-12 working days.

T-cell Activation Antigen CD27 (CD27) Antibody
abx414870-025mg	Abbexa	0.25 mg	EUR 565
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody
abx415298-01mg	Abbexa	0.1 mg	EUR 453
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody
abx415489-01mg	Abbexa	0.1 mg	EUR 439
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody
abx415492-1mg	Abbexa	1 mg	EUR 829
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody
abx432467-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

T-cell Activation Antigen CD27 (CD27) Antibody
20-abx306428	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

T-cell Activation Antigen CD27 (CD27) Antibody
20-abx225088	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

T-cell Activation Antigen CD27 (CD27) Antibody
abx231453-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

T-cell Activation Antigen CD27 (CD27) Antibody
20-abx001588	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Human CD27 Antibody
32149-05111	AssayPro	150 ug	EUR 261

CD27 antibody (FITC)
61R-1068	Fitzgerald	100 ug	EUR 208
Description: Armenian Hamster monoclonal CD27 antibody (FITC)

CD27 antibody (PE)
61R-1230	Fitzgerald	100 ug	EUR 316
Description: Armenian Hamster monoclonal CD27 antibody (PE)

CD27 antibody (biotin)
61R-1486	Fitzgerald	100 ug	EUR 219
Description: Armenian Hamster monoclonal CD27 antibody (biotin)

CD27 antibody (biotin)
61R-1487	Fitzgerald	100 ug	EUR 316
Description: Mouse monoclonal CD27 antibody (biotin)

CD27 antibody (allophycocyanin)
61R-1716	Fitzgerald	100 ug	EUR 478
Description: Armenian Hamster monoclonal CD27 antibody (allophycocyanin)

CD27 Conjugated Antibody
C49854	SAB	100ul	EUR 397

CD27(203.6) Antibody
BNUB0163-100	Biotium	100uL	EUR 209
Description: Primary antibody against CD27(203.6), Concentration: 0.2mg/mL

CD27(203.6) Antibody
BNUB0163-500	Biotium	500uL	EUR 458
Description: Primary antibody against CD27(203.6), Concentration: 0.2mg/mL

CD27(203.6) Antibody
BNUM0163-50	Biotium	50uL	EUR 395
Description: Primary antibody against CD27(203.6), 1mg/mL

CD27(203.6) Antibody
BNC040163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF405S conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC040163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF405S conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC610163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF660R conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC610163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF660R conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC470163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF647 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC470163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF647 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC550163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF555 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC550163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF555 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC050163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF405M conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC050163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF405M conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC400163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF640R conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC400163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF640R conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC430163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF543 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC430163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF543 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC800163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF680 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC800163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF680 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC810163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF680R conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC810163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF680R conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNCP0163-250	Biotium	250uL	EUR 383
Description: Primary antibody against CD27(203.6), PerCP conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNCR0163-250	Biotium	250uL	EUR 383
Description: Primary antibody against CD27(203.6), RPE conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNCA0163-250	Biotium	250uL	EUR 383
Description: Primary antibody against CD27(203.6), APC conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNCAP0163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNCAP0163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNCH0163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNCH0163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC940163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF594 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC940163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF594 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC700163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF770 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC700163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF770 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNCB0163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), Biotin conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNCB0163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), Biotin conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC880163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF488A conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC880163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF488A conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC680163-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD27(203.6), CF568 conjugate, Concentration: 0.1mg/mL

CD27(203.6) Antibody
BNC680163-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD27(203.6), CF568 conjugate, Concentration: 0.1mg/mL

anti- CD27 antibody
FNab01453	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 Immunogen: CD27 molecule Uniprot ID: P26842 Gene ID: 939 Research Area: Stem Cells, Immunology, Signal Transduction
Description: Antibody raised against CD27

Anti-CD27 antibody
PAab01453	Lifescience Market	100 ug	EUR 355

Anti-CD27 Antibody
PB9931	BosterBio	100ug/vial	EUR 334

Anti-CD27 antibody
STJ118114	St John's Laboratory	100 µl	EUR 277

Anti-CD27 antibody
STJ16100092	St John's Laboratory	100 µg	EUR 406

Anti-CD27 antibody
STJ16100093	St John's Laboratory	100 tests	EUR 615

Anti-CD27 antibody
STJ16101136	St John's Laboratory	100 µg	EUR 354

Anti-CD27 antibody
STJ22984	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is required for generation and long-term maintenance of T cell immunity. It binds to ligand CD70, and plays a key role in regulating B-cell activation and immunoglobulin synthesis. This receptor transduces signals that lead to the activation of NF-kappaB and MAPK8/JNK. Adaptor proteins TRAF2 and TRAF5 have been shown to mediate the signaling process of this receptor. CD27-binding protein (SIVA), a proapoptotic protein, can bind to this receptor and is thought to play an important role in the apoptosis induced by this receptor.

Anti-CD27 antibody
STJ191672	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CD27

Polyclonal Goat Anti-CD27 Antibody (internal region)
APG00952G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CD27 (internal region). This antibody is tested and proven to work in the following applications:

CD27 Binding Protein (CD27BP) Polyclonal Antibody (Human)
4-PAM233Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD27BP (Met1~Thr175) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD27 Binding Protein (CD27BP)

T-cell Activation Antigen CD27 (CD27) Antibody (FITC)
abx200208-100tests	Abbexa	100 tests	EUR 425
Shipped within 3-5 working days.

T-cell Activation Antigen CD27 (CD27) Antibody (PE)
abx200209-100tests	Abbexa	100 tests	EUR 495
Shipped within 3-5 working days.

T-cell Activation Antigen CD27 (CD27) Antibody (APC)
abx200210-100tests	Abbexa	100 tests	EUR 718
Shipped within 3-5 working days.

T-cell Activation Antigen CD27 (CD27) Antibody (PE)
abx139211-100tests	Abbexa	100 tests	EUR 481
Shipped within 5-12 working days.

T-cell Activation Antigen CD27 (CD27) Antibody (APC)
abx139212-100tests	Abbexa	100 tests	EUR 481
Shipped within 5-12 working days.

T-cell Activation Antigen CD27 (CD27) Antibody (FITC)
abx139213-100tests	Abbexa	100 tests	EUR 425
Shipped within 5-12 working days.

T-cell Activation Antigen CD27 (CD27) Antibody (Biotin)
abx414871-01mg	Abbexa	0.1 mg	EUR 509
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody (FITC)
abx414872-01mg	Abbexa	0.1 mg	EUR 509
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody (RPE)
abx414873-01mg	Abbexa	0.1 mg	EUR 592
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody (APC)
abx415296-100tests	Abbexa	100 tests	EUR 718
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody (FITC)
abx415297-01mg	Abbexa	0.1 mg	EUR 648
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody (RPE)
abx415299-100tests	Abbexa	100 tests	EUR 718
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody (FITC)
abx415488-01mg	Abbexa	0.1 mg	EUR 509
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody (RPE)
abx415490-100tests	Abbexa	100 tests	EUR 592
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody (RPE)
abx415491-25tests025ml	Abbexa	25 tests (0.25 ml)	EUR 314
Shipped within 1 week.

T-cell Activation Antigen CD27 (CD27) Antibody (HRP)
20-abx306429	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

T-cell Activation Antigen CD27 (CD27) Antibody (FITC)
20-abx306430	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

T-cell Activation Antigen CD27 (CD27) Antibody (Biotin)
20-abx306431	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rat CD27 antigen(CD27) ELISA kit
E02C1473-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CD27 antigen(CD27) ELISA kit
E02C1473-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CD27 antigen(CD27) ELISA kit
E02C1473-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CD27 antigen(CD27) ELISA kit
E06C1473-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CD27 antigen(CD27) ELISA kit
E06C1473-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CD27 antigen(CD27) ELISA kit
E06C1473-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD27 antigen(CD27) ELISA kit
E03C1473-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD27 antigen(CD27) ELISA kit
E03C1473-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD27 antigen(CD27) ELISA kit
E03C1473-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD27 antigen(CD27) ELISA kit
E01C1473-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD27 antigen(CD27) ELISA kit
E01C1473-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD27 antigen(CD27) ELISA kit
E01C1473-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CD27 antigen(CD27) ELISA kit
E07C1473-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CD27 antigen(CD27) ELISA kit
E07C1473-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CD27 antigen(CD27) ELISA kit
E07C1473-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD27 Antigen (CD27) ELISA Kit
20-abx156729	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Monkey CD27 antigen(CD27) ELISA kit
E09C1473-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CD27 antigen(CD27) ELISA kit
E09C1473-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CD27 antigen(CD27) ELISA kit
E09C1473-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CD27 antigen(CD27) ELISA kit
E08C1473-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CD27 antigen(CD27) ELISA kit
E08C1473-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CD27 antigen(CD27) ELISA kit
E08C1473-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD27 antigen, CD27 ELISA KIT
ELI-10382h	Lifescience Market	96 Tests	EUR 824

Human CD27 antigen(CD27) ELISA kit
CSB-EL004910HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CD27 antigen (CD27) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human CD27 antigen(CD27) ELISA kit
1-CSB-EL004910HU	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CD27 antigen(CD27) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse CD27 antigen(CD27) ELISA kit
CSB-EL004910MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse CD27 antigen (CD27) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse CD27 antigen(CD27) ELISA kit
1-CSB-EL004910MO	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse CD27 antigen(CD27) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse CD27 antigen, Cd27 ELISA KIT
ELI-33094m	Lifescience Market	96 Tests	EUR 865

CD27 siRNA
20-abx910982	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CD27 siRNA
20-abx910983	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pENTR223-CD27
PVT12720	Lifescience Market	2 ug	EUR 391

anti-CD27
YF-PA10777	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CD27

anti-CD27
YF-PA10778	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to CD27

T-cell Activation Antigen CD27 (CD27) Antibody (PerCP-Cy5.5)
abx200211-100tests	Abbexa	100 tests	EUR 481
Shipped within 3-5 working days.

CD27 Antibody, HRP conjugated
1-CSB-PA08235B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD27. Recognizes CD27 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CD27 Antibody, FITC conjugated
1-CSB-PA08235C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD27. Recognizes CD27 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CD27 Antibody, Biotin conjugated
1-CSB-PA08235D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD27. Recognizes CD27 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CD27 recombinant monoclonal antibody
A5851	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human CD27 for WB,ELISA

CD27 Binding Protein (CD27BP) Polyclonal Antibody (Human), APC
4-PAM233Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD27BP (Met1~Thr175) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD27 Binding Protein (CD27BP). This antibody is labeled with APC.

CD27 Binding Protein (CD27BP) Polyclonal Antibody (Human), Biotinylated
4-PAM233Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD27BP (Met1~Thr175) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD27 Binding Protein (CD27BP). This antibody is labeled with Biotin.

CD27 Binding Protein (CD27BP) Polyclonal Antibody (Human), Cy3
4-PAM233Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD27BP (Met1~Thr175) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD27 Binding Protein (CD27BP). This antibody is labeled with Cy3.

CD27 Binding Protein (CD27BP) Polyclonal Antibody (Human), FITC
4-PAM233Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD27BP (Met1~Thr175) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD27 Binding Protein (CD27BP). This antibody is labeled with FITC.

CD27 Binding Protein (CD27BP) Polyclonal Antibody (Human), HRP
4-PAM233Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD27BP (Met1~Thr175) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD27 Binding Protein (CD27BP). This antibody is labeled with HRP.

CD27 Binding Protein (CD27BP) Polyclonal Antibody (Human), PE
4-PAM233Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD27BP (Met1~Thr175) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD27 Binding Protein (CD27BP). This antibody is labeled with PE.

Guinea pig CD27 antigen(CD27) ELISA kit
E05C1473-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CD27 antigen(CD27) ELISA kit
E05C1473-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CD27 antigen(CD27) ELISA kit
E05C1473-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig CD27 antigen(CD27) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

T-cell Activation Antigen CD27 (CD27) Protein
20-abx260944	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Recombinant Cynomolgus CD27 molecule/CD27(C-6His)
C960-10ug	Novoprotein	10ug	EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mMTris,150mM NaCl,pH8.5.

Recombinant Cynomolgus CD27 molecule/CD27(C-6His)
C960-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mMTris,150mM NaCl,pH8.5.

Recombinant Cynomolgus CD27 molecule/CD27(C-6His)
C960-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mMTris,150mM NaCl,pH8.5.

Recombinant Cynomolgus CD27 molecule/CD27(C-6His)
C960-50ug	Novoprotein	50ug	EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mMTris,150mM NaCl,pH8.5.

Recombinant Cynomolgus CD27 molecule/CD27(C-6His)
CA62-10ug	Novoprotein	10ug	EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Cynomolgus CD27 molecule/CD27(C-6His)
CA62-1mg	Novoprotein	1mg	EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Cynomolgus CD27 molecule/CD27(C-6His)
CA62-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Cynomolgus CD27 molecule/CD27(C-6His)
CA62-50ug	Novoprotein	50ug	EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

T-cell Activation Antigen CD27 (CD27) Antibody (PE-DyLight 594)
abx139210-100tests	Abbexa	100 tests	EUR 523
Shipped within 5-12 working days.

CD27 Binding Protein (CD27BP) Polyclonal Antibody (Human), APC-Cy7
4-PAM233Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD27BP (Met1~Thr175) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD27 Binding Protein (CD27BP). This antibody is labeled with APC-Cy7.

Human CD27 Antibody (Biotin Conjugate)
32149-05121	AssayPro	150 ug	EUR 369

CD27 Binding Protein (CD27BP) Antibody
20-abx128888	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CD27 Binding Protein (CD27BP) Antibody
20-abx171657	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Anti-CD27 Antibody (LPFS2/1611)
A1483-100	Biovision		EUR 479

Anti-CD27 (aa161-175) antibody
STJ73070	St John's Laboratory	100 µg	EUR 359

CD27 Blocking Peptide
33R-5024	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD27 antibody, catalog no. 70R-9668

CD27 Blocking Peptide
DF6709-BP	Affbiotech	1mg	EUR 195

CD27 Blocking Peptide
DF2296-BP	Affbiotech	1mg	EUR 195

CD27 cloning plasmid
CSB-CL004910HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 783 Sequence: atggcacggccacatccctggtggctgtgcgttctggggaccctggtggggctctcagctactccagcccccaagagctgcccagagaggcactactgggctcagggaaagctgtgctgccagatgtgtgagccaggaacattcctcgtgaaggactgtgaccagcatagaaaggc Show more
Description: A cloning plasmid for the CD27 gene.

Human CD27 AssayLite Antibody (FITC Conjugate)
32149-05141	AssayPro	150 ug	EUR 428

Human CD27 AssayLite Antibody (RPE Conjugate)
32149-05151	AssayPro	150 ug	EUR 428

Human CD27 AssayLite Antibody (APC Conjugate)
32149-05161	AssayPro	150 ug	EUR 428

Human CD27 AssayLite Antibody (PerCP Conjugate)
32149-05171	AssayPro	150 ug	EUR 471

Hamster Anti Mouse Cd27 Monoclonal Antibody
CABT-54688HM	Creative Diagnostics	0.25 mg	EUR 663

Anti-CD27 Antibody [O323], Unconjugated-100ug
QAB36-100ug	EnQuireBio	100ug	EUR 141

Anti-CD27 Antibody [O323], APC-100Tests
QAB36-APC-100Tests	EnQuireBio	100Tests	EUR 276

Anti-CD27 Antibody [O323], APC-25Tests
QAB36-APC-25Tests	EnQuireBio	25Tests	EUR 166

Anti-CD27 Antibody [O323], FITC-100Tests
QAB36-F-100Tests	EnQuireBio	100Tests	EUR 200

Anti-CD27 Antibody [O323], FITC-25Tests
QAB36-F-25Tests	EnQuireBio	25Tests	EUR 123

Anti-CD27 Antibody [O323], PE-100Tests
QAB36-PE-100Tests	EnQuireBio	100Tests	EUR 216

Anti-CD27 Antibody [O323], PE-25Tests
QAB36-PE-25Tests	EnQuireBio	25Tests	EUR 131

Anti-CD27 Antibody [O323], V450-100Tests
QAB36-V450-100Tests	EnQuireBio	100Tests	EUR 259

Anti-CD27 Antibody [O323], V450-25Tests
QAB36-V450-25Tests	EnQuireBio	25Tests	EUR 157

Anti-Hu CD27 Purified
11-308-C025	ExBio	0.025 mg	EUR 99

Anti-Hu CD27 Purified
11-308-C100	ExBio	0.1 mg	EUR 158

Anti-Hu CD27 APC
1A-308-T025	ExBio	25 tests	EUR 140

Anti-Hu CD27 APC
1A-308-T100	ExBio	100 tests	EUR 240

Anti-Hu CD27 FITC
1F-308-T025	ExBio	25 tests	EUR 122

Anti-Hu CD27 FITC
1F-308-T100	ExBio	100 tests	EUR 204

Anti-Hu CD27 PE
1P-308-T025	ExBio	25 tests	EUR 140

Anti-Hu CD27 PE
1P-308-T100	ExBio	100 tests	EUR 240

Human CD27 ELISA kit
55R-2259	Fitzgerald	1 kit	EUR 860
Description: ELISA kit for detection of CD27 (TNFRSF7) in the research laboratory

CD27 protein (His tag)
80R-2462	Fitzgerald	20 ug	EUR 322
Description: Purified recombinant CD27 protein (His tag)

CD27 ELISA KIT|Human
EF008505	Lifescience Market	96 Tests	EUR 689

Mouse CD27 shRNA Plasmid
20-abx973161	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CD27 shRNA Plasmid
20-abx950661	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CD27 Human Recombinant Protein
PROTP26842	BosterBio	Regular: 20ug	EUR 317
Description: CD27 Human Recombinant produced in E. coli is a single polypeptide chain containing 196 amino acids (21-191) and having a molecular mass of 21.8 kDa.;CD27 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CD27 Recombinant Protein (Human)
RP006316	ABM	100 ug	Ask for price

CD27 Recombinant Protein (Rat)
RP193904	ABM	100 ug	Ask for price

CD27 Recombinant Protein (Mouse)
RP122483	ABM	100 ug	Ask for price

CD27 Recombinant Protein (Mouse)
RP122486	ABM	100 ug	Ask for price

Anti-CD27 (1E2-A3)
YF-MA12321	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CD27

Mouse Anti Human Cd27 Monoclonal Antibody,RPE
CABT-48057MH	Creative Diagnostics	100 TEST	EUR 710

Anti-CD27 Antibody [O323], APC-Cy7-100Tests
QAB36-APC7-100Tests	EnQuireBio	100Tests	EUR 276

Anti-CD27 Antibody [O323], APC-Cy7-25Tests
QAB36-APC7-25Tests	EnQuireBio	25Tests	EUR 166

Anti-CD27 Antibody [O323], PE-Cy7-100Tests
QAB36-PE7-100Tests	EnQuireBio	100Tests	EUR 301

Anti-CD27 Antibody [O323], PE-Cy7-25Tests
QAB36-PE7-25Tests	EnQuireBio	25Tests	EUR 182

Anti-CD27 Antibody [O323], Qfluor 630-100ug
QAB36-QF630-100ug	EnQuireBio	100ug	EUR 216

CD27 / TNFRSF7 (Human) ELISA Kit
E4547-100	Biovision		EUR 865

Human TNFRSF7/CD27 ELISA Kit
LF-EK50881	Abfrontier	1×96T	EUR 648

Mouse TNFRSF7/CD27 ELISA Kit
LF-EK50882	Abfrontier	1×96T	EUR 648

Cd27 ORF Vector (Rat) (pORF)
ORF064636	ABM	1.0 ug DNA	EUR 506

CD27 ORF Vector (Human) (pORF)
ORF002106	ABM	1.0 ug DNA	EUR 95

Cd27 ORF Vector (Mouse) (pORF)
ORF040829	ABM	1.0 ug DNA	EUR 506

Cd27 ORF Vector (Mouse) (pORF)
ORF040830	ABM	1.0 ug DNA	EUR 506

Anti-Hu CD27 Pacific Blue
PB-308-T025	ExBio	25 tests	EUR 154

Anti-Hu CD27 Pacific Blue
PB-308-T100	ExBio	100 tests	EUR 269

Anti-Hu CD27 Pacific Orange
PO-308-T025	ExBio	25 tests	EUR 154

Anti-Hu CD27 Pacific Orange
PO-308-T100	ExBio	100 tests	EUR 269

Recombinant CD27 Binding Protein (CD27BP)
4-RPM233Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O15304 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.5kDa Isoelectric Point: 8.2
Description: Recombinant Human CD27 Binding Protein expressed in: E.coli

pECMV-Cd27-m-FLAG Plasmid
PVT15294	Lifescience Market	2 ug	EUR 325

Recombinant Human CD27/TNFRSF7 Protein
RP00326	Abclonal	10 μg	EUR 136

Anti-Hu CD27 APC-Cy7
T4-308-T100	ExBio	100 tests	EUR 268

Anti-Hu CD27 PE-DyLight594
T5-308-T025	ExBio	25 tests	EUR 154

Anti-Hu CD27 PE-DyLight594
T5-308-T100	ExBio	100 tests	EUR 268

Anti-Hu CD27 PE-Cy7
T7-308-T025	ExBio	25 tests	EUR 154

Anti-Hu CD27 PE-Cy7
T7-308-T100	ExBio	100 tests	EUR 268

Anti-Hu CD27 PE-Cy5
T8-308-T025	ExBio	25 tests	EUR 140

Anti-Hu CD27 PE-Cy5
T8-308-T100	ExBio	100 tests	EUR 240

Anti-Hu CD27 PerCP-Cy5.5
T9-308-T025	ExBio	25 tests	EUR 196

Anti-Hu CD27 PerCP-Cy5.5
T9-308-T100	ExBio	100 tests	EUR 352

CD27 ELISA Kit (Human) (OKCD07090)
OKCD07090	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is required for generation and long-term maintenance of T cell immunity. It binds to ligand CD70, and plays a key role in regulating B-cell activation and immunoglobulin synthesis. This receptor transduces signals that lead to the activation of NF-kappaB and MAPK8/JNK. Adaptor proteins TRAF2 and TRAF5 have been shown to mediate the signaling process of this receptor. CD27-binding protein (SIVA), a proapoptotic protein, can bind to this receptor and is thought to play an important role in the apoptosis induced by this receptor.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.065ng/mL

Anti-CD27 Antibody Clone LPFS2/1611, Unconjugated-20ug
939-MSM2-P0	EnQuireBio	20ug	EUR 233

Anti-CD27 Antibody Clone LPFS2/1611, Unconjugated-100ug
939-MSM2-P1	EnQuireBio	100ug	EUR 428

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody
ABP57581-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG14L Rabbit Polyclonal Antibody
ABP57583-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

NBR1 Rabbit Polyclonal Antibody
ABP57585-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1