CD5L Rabbit Polyclonal Antibody
CD5L Polyclonal Antibody |
ABP58070-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CD5L protein at amino acid sequence of 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of CD5L from Human, Mouse. This CD5L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD5L protein at amino acid sequence of 220-300 |
CD5L Polyclonal Antibody |
ABP58070-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CD5L protein at amino acid sequence of 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of CD5L from Human, Mouse. This CD5L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD5L protein at amino acid sequence of 220-300 |
CD5L Rabbit pAb |
A6223-100ul |
Abclonal |
100 ul |
EUR 308 |
CD5L Rabbit pAb |
A6223-200ul |
Abclonal |
200 ul |
EUR 459 |
CD5L Rabbit pAb |
A6223-20ul |
Abclonal |
20 ul |
EUR 183 |
CD5L Rabbit pAb |
A6223-50ul |
Abclonal |
50 ul |
EUR 223 |
Human CD5 Antigen Like Protein (CD5L) ELISA Kit |
DLR-CD5L-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human CD5 Antigen Like Protein (CD5L) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human CD5 Antigen Like Protein (CD5L) ELISA Kit |
DLR-CD5L-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human CD5 Antigen Like Protein (CD5L) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit |
DLR-CD5L-Mu-48T |
DL Develop |
48T |
EUR 566 |
- Should the Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse CD5 Antigen Like Protein (CD5L) in samples from serum, plasma or other biological fluids. |
Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit |
DLR-CD5L-Mu-96T |
DL Develop |
96T |
EUR 741 |
- Should the Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse CD5 Antigen Like Protein (CD5L) in samples from serum, plasma or other biological fluids. |
Human CD5 Antigen Like Protein (CD5L) ELISA Kit |
RD-CD5L-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human CD5 Antigen Like Protein (CD5L) ELISA Kit |
RD-CD5L-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit |
RD-CD5L-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 577 |
Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit |
RD-CD5L-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 802 |
Human CD5 Antigen Like Protein (CD5L) ELISA Kit |
RDR-CD5L-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human CD5 Antigen Like Protein (CD5L) ELISA Kit |
RDR-CD5L-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit |
RDR-CD5L-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 603 |
Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit |
RDR-CD5L-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 840 |
Rabbit CD5L ELISA Kit |
ERTC0038 |
Abclonal |
96Tests |
EUR 521 |
CD5L Antibody |
37478-100ul |
SAB |
100ul |
EUR 252 |
CD5L antibody |
38759-100ul |
SAB |
100ul |
EUR 252 |
CD5L Antibody |
1-CSB-PA867465 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100 |
CD5L Antibody |
DF2304 |
Affbiotech |
200ul |
EUR 304 |
Description: CD5L antibody detects endogenous levels of total CD5L. |
CD5L Antibody |
1-CSB-PA004948ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000 |
CD5L Antibody |
1-CSB-PA563352 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
Polyclonal AIM / CD5L Antibody (N-Terminus) |
APR02297G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AIM / CD5L (N-Terminus). This antibody is tested and proven to work in the following applications: |
Anti-CD5L antibody |
STJ191677 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CD5L |
CD5L siRNA |
20-abx911054 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD5L siRNA |
20-abx911055 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD5l protein |
80R-4353 |
Fitzgerald |
50 ug |
EUR 349 |
Description: Purified Recombinant CD5l protein (His tagged) |
anti-CD5L |
YF-PA10755 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to CD5L |
anti-CD5L |
YF-PA10756 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to CD5L |
anti-CD5L |
YF-PA27189 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CD5L |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human) |
4-PAL300Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Pro133~Arg256)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L) |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse) |
4-PAL300Mu01 |
Cloud-Clone |
-
EUR 266.00
-
EUR 2813.00
-
EUR 694.00
-
EUR 337.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Glu22~Val352)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L) |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat) |
4-PAL300Ra01 |
Cloud-Clone |
-
EUR 275.00
-
EUR 2958.00
-
EUR 727.00
-
EUR 350.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Leu11~Leu346)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L) |
CD5L cloning plasmid |
CSB-CL004948HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1044
- Sequence: atggctctgctattctccttgatccttgccatttgcaccagacctggattcctagcgtctccatctggagtgcggctggtggggggcctccaccgctgtgaagggcgggtggaggtggaacagaaaggccagtggggcaccgtgtgtgatgacggctgggacattaaggacgtgg
- Show more
|
Description: A cloning plasmid for the CD5L gene. |
CD5L Blocking Peptide |
DF2304-BP |
Affbiotech |
1mg |
EUR 195 |
anti-CD5L (1C8) |
LF-MA10050 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CD5L |
CD5 Molecule Like (CD5L) Antibody |
20-abx004754 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
CD5 Molecule Like (CD5L) Antibody |
abx031276-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
CD5 Molecule Like (CD5L) Antibody |
abx031276-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
CD5 Molecule Like (CD5L) Antibody |
20-abx321419 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD5 Molecule Like (CD5L) Antibody |
abx411856-01mg |
Abbexa |
0.1 mg |
EUR 509 |
|
CD5 Molecule Like (CD5L) Antibody |
abx411857-01mg |
Abbexa |
0.1 mg |
EUR 509 |
|
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), APC |
4-PAL300Hu01-APC |
Cloud-Clone |
-
EUR 368.00
-
EUR 3599.00
-
EUR 993.00
-
EUR 472.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Pro133~Arg256)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), Biotinylated |
4-PAL300Hu01-Biotin |
Cloud-Clone |
-
EUR 328.00
-
EUR 2697.00
-
EUR 786.00
-
EUR 404.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Pro133~Arg256)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), Cy3 |
4-PAL300Hu01-Cy3 |
Cloud-Clone |
-
EUR 449.00
-
EUR 4757.00
-
EUR 1283.00
-
EUR 588.00
-
EUR 264.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Pro133~Arg256)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), FITC |
4-PAL300Hu01-FITC |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Pro133~Arg256)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), HRP |
4-PAL300Hu01-HRP |
Cloud-Clone |
-
EUR 335.00
-
EUR 3135.00
-
EUR 877.00
-
EUR 426.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Pro133~Arg256)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), PE |
4-PAL300Hu01-PE |
Cloud-Clone |
-
EUR 314.00
-
EUR 2899.00
-
EUR 814.00
-
EUR 397.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Pro133~Arg256)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), APC |
4-PAL300Mu01-APC |
Cloud-Clone |
-
EUR 374.00
-
EUR 3689.00
-
EUR 1016.00
-
EUR 481.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Glu22~Val352)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), Biotinylated |
4-PAL300Mu01-Biotin |
Cloud-Clone |
-
EUR 332.00
-
EUR 2763.00
-
EUR 803.00
-
EUR 411.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Glu22~Val352)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), Cy3 |
4-PAL300Mu01-Cy3 |
Cloud-Clone |
-
EUR 457.00
-
EUR 4877.00
-
EUR 1313.00
-
EUR 600.00
-
EUR 267.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Glu22~Val352)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), FITC |
4-PAL300Mu01-FITC |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Glu22~Val352)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), HRP |
4-PAL300Mu01-HRP |
Cloud-Clone |
-
EUR 341.00
-
EUR 3213.00
-
EUR 897.00
-
EUR 433.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Glu22~Val352)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), PE |
4-PAL300Mu01-PE |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Glu22~Val352)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), APC |
4-PAL300Ra01-APC |
Cloud-Clone |
-
EUR 388.00
-
EUR 3887.00
-
EUR 1065.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Leu11~Leu346)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), Biotinylated |
4-PAL300Ra01-Biotin |
Cloud-Clone |
-
EUR 343.00
-
EUR 2908.00
-
EUR 839.00
-
EUR 425.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Leu11~Leu346)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), Cy3 |
4-PAL300Ra01-Cy3 |
Cloud-Clone |
-
EUR 476.00
-
EUR 5141.00
-
EUR 1379.00
-
EUR 626.00
-
EUR 275.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Leu11~Leu346)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), FITC |
4-PAL300Ra01-FITC |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Leu11~Leu346)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), HRP |
4-PAL300Ra01-HRP |
Cloud-Clone |
-
EUR 353.00
-
EUR 3385.00
-
EUR 940.00
-
EUR 451.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Leu11~Leu346)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), PE |
4-PAL300Ra01-PE |
Cloud-Clone |
-
EUR 330.00
-
EUR 3129.00
-
EUR 872.00
-
EUR 420.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Leu11~Leu346)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), APC-Cy7 |
4-PAL300Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 616.00
-
EUR 7078.00
-
EUR 1867.00
-
EUR 824.00
-
EUR 338.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Pro133~Arg256)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAL300Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 628.00
-
EUR 7258.00
-
EUR 1912.00
-
EUR 842.00
-
EUR 344.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Glu22~Val352)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7. |
CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAL300Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 657.00
-
EUR 7654.00
-
EUR 2011.00
-
EUR 882.00
-
EUR 355.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD5L (Leu11~Leu346)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7. |
CD5 Antigen Like Protein (CD5L) Antibody |
20-abx102422 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
CD5 Antigen Like Protein (CD5L) Antibody |
20-abx102423 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
CD5 Antigen Like Protein (CD5L) Antibody |
20-abx102424 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
CD5 Antigen Like Protein (CD5L) Antibody |
20-abx175765 |
Abbexa |
|
|
|
CD5 Antigen Like Protein (CD5L) Antibody |
20-abx212176 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD5 Antigen Like Protein (CD5L) Antibody |
20-abx212250 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD5 Antigen Like Protein (CD5L) Antibody |
20-abx171658 |
Abbexa |
|
|
|
Human CD5L ELISA Kit |
EHC0038 |
Abclonal |
96Tests |
EUR 521 |
Goat CD5L ELISA Kit |
EGTC0038 |
Abclonal |
96Tests |
EUR 521 |
Canine CD5L ELISA Kit |
ECC0038 |
Abclonal |
96Tests |
EUR 521 |
Chicken CD5L ELISA Kit |
ECKC0038 |
Abclonal |
96Tests |
EUR 521 |
Bovine CD5L ELISA Kit |
EBC0038 |
Abclonal |
96Tests |
EUR 521 |
Anserini CD5L ELISA Kit |
EAC0038 |
Abclonal |
96Tests |
EUR 521 |
Rat CD5L ELISA Kit |
ERC0038 |
Abclonal |
96Tests |
EUR 521 |
Sheep CD5L ELISA Kit |
ESC0038 |
Abclonal |
96Tests |
EUR 521 |
Porcine CD5L ELISA Kit |
EPC0038 |
Abclonal |
96Tests |
EUR 521 |
Mouse CD5L ELISA Kit |
EMC0038 |
Abclonal |
96Tests |
EUR 521 |
Monkey CD5L ELISA Kit |
EMKC0038 |
Abclonal |
96Tests |
EUR 521 |
Human CD5L shRNA Plasmid |
20-abx950650 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CD5L shRNA Plasmid |
20-abx969186 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CD5L Recombinant Protein (Human) |
RP006394 |
ABM |
100 ug |
Ask for price |
CD5L Recombinant Protein (Rat) |
RP194000 |
ABM |
100 ug |
Ask for price |
CD5L Recombinant Protein (Mouse) |
RP122657 |
ABM |
100 ug |
Ask for price |
Monoclonal CD5L Antibody (monoclonal) (M01), Clone: 1C8 |
AMM03348G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human CD5L (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1C8. This antibody is applicable in WB, IP, E |
CD5 Antigen Like Protein (CD5L) Antibody (FITC) |
20-abx271230 |
Abbexa |
-
EUR 523.00
-
EUR 258.00
-
EUR 1581.00
-
EUR 732.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
CD5 Antigen Like Protein (CD5L) Antibody (FITC) |
20-abx271282 |
Abbexa |
-
EUR 537.00
-
EUR 272.00
-
EUR 1664.00
-
EUR 759.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
CD5 Antigen Like Protein (CD5L) Antibody (Biotin) |
20-abx271496 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1469.00
-
EUR 690.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
CD5 Antigen Like Protein (CD5L) Antibody (Biotin) |
20-abx271548 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1539.00
-
EUR 718.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
CD5 Antigen Like Protein (CD5L) Antibody (Biotin) |
20-abx272488 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1428.00
-
EUR 676.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human CD5L PicoKine ELISA Kit |
EK1413 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of activated human CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
Mouse CD5L PicoKine ELISA Kit |
EK1414 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of activated mouse CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
ELISA kit for Human CD5L |
EK5657 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CD5L in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Mouse CD5L |
EK5658 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CD5L in samples from serum, plasma, tissue homogenates and other biological fluids. |
Guinea Pig CD5L ELISA Kit |
EGC0038 |
Abclonal |
96Tests |
EUR 521 |
CD5L ORF Vector (Human) (pORF) |
ORF002132 |
ABM |
1.0 ug DNA |
EUR 95 |
Cd5l ORF Vector (Mouse) (pORF) |
ORF040887 |
ABM |
1.0 ug DNA |
EUR 506 |
Cd5l ORF Vector (Rat) (pORF) |
ORF064668 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Human CD5L/API6 Protein |
RP00198 |
Abclonal |
10 μg |
EUR 155 |
CD5L sgRNA CRISPR Lentivector set (Human) |
K0400201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cd5l sgRNA CRISPR Lentivector set (Mouse) |
K4335001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cd5l sgRNA CRISPR Lentivector set (Rat) |
K7473601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant CD5 Antigen Like Protein (CD5L) |
4-RPL300Hu01 |
Cloud-Clone |
-
EUR 386.72
-
EUR 206.00
-
EUR 1175.20
-
EUR 458.40
-
EUR 816.80
-
EUR 322.00
-
EUR 2788.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O43866
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 15.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human CD5 Antigen Like Protein expressed in: E.coli |
Recombinant CD5 Antigen Like Protein (CD5L) |
4-RPL300Mu01 |
Cloud-Clone |
-
EUR 444.06
-
EUR 222.00
-
EUR 1390.24
-
EUR 530.08
-
EUR 960.16
-
EUR 360.00
-
EUR 3325.60
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9QWK4
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 63.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse CD5 Antigen Like Protein expressed in: E.coli |
Recombinant CD5 Antigen Like Protein (CD5L) |
4-RPL300Ra01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q4KM75
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 63.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat CD5 Antigen Like Protein expressed in: E.coli |
Human CD5 Antigen-Like (CD5L) ELISA Kit |
abx576076-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human CD5L/ CD5 antigen-like ELISA Kit |
E0433Hu |
Sunlong |
1 Kit |
EUR 605 |
Mouse Cd5l/ CD5 antigen-like ELISA Kit |
E0255Mo |
Sunlong |
1 Kit |
EUR 571 |
Human CD5L(CD5 antigen-like) ELISA Kit |
EH2229 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: O43866
- Alias: CD5L/AIM/API6/CT-2/SP-alpha/apoptosis inhibitor 6/CD5 antigen-like(scavenger receptor cysteine rich family)/CD5 molecule-like/IgM-associated peptide/PRO229/Spalpha/SP-ALPHA
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.156--10 ng/ml |
Mouse CD5l( CD5 antigen-like) ELISA Kit |
EM0762 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.2-2000 pg/ml
- Uniprot ID: Q9QWK4
- Alias: CD5l/AIM/API6/CT-2/SP-alpha/apoptosis inhibitor 6/CD5 antigen-like(scavenger receptor cysteine rich family)/CD5 molecule-like/IgM-associated peptide/PRO229/Spalpha/SP-ALPHA
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml |
CD5L sgRNA CRISPR Lentivector (Human) (Target 1) |
K0400202 |
ABM |
1.0 ug DNA |
EUR 154 |
CD5L sgRNA CRISPR Lentivector (Human) (Target 2) |
K0400203 |
ABM |
1.0 ug DNA |
EUR 154 |
CD5L sgRNA CRISPR Lentivector (Human) (Target 3) |
K0400204 |
ABM |
1.0 ug DNA |
EUR 154 |
Mouse CD5 Antigen Like Protein (CD5L) Protein |
20-abx065842 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1873.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human CD5 Antigen Like Protein (CD5L) Protein |
20-abx065843 |
Abbexa |
-
EUR 551.00
-
EUR 244.00
-
EUR 1595.00
-
EUR 648.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat CD5 Antigen Like Protein (CD5L) Protein |
20-abx065844 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Mouse CD5 Antigen-Like (CD5L) ELISA Kit |
20-abx153802 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human CD5 Antigen-Like (CD5L) ELISA Kit |
20-abx151004 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse CD5 Antigen-Like (CD5L) ELISA Kit |
abx255110-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
CD5L Rabbit Polyclonal Antibody