Da vinci european bio bank

CD5L Rabbit Polyclonal Antibody

CD5L Polyclonal Antibody
ES10519-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD5L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CD5L Polyclonal Antibody
ES10519-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD5L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rabbit Anti Cd5l (C-Terminal) Polyclonal Antibody
CPBT-65327RC	Creative Diagnostics	0.1 mg	EUR 710

CD5L Rabbit pAb
A6223-100ul	Abclonal	100 ul	EUR 308

CD5L Rabbit pAb
A6223-200ul	Abclonal	200 ul	EUR 459

CD5L Rabbit pAb
A6223-20ul	Abclonal	20 ul	EUR 183

CD5L Rabbit pAb
A6223-50ul	Abclonal	50 ul	EUR 223

Human CD5 Antigen Like Protein (CD5L) ELISA Kit
DLR-CD5L-Hu-48T	DL Develop	48T	EUR 554
Should the Human CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human CD5 Antigen Like Protein (CD5L) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human CD5 Antigen Like Protein (CD5L) ELISA Kit
DLR-CD5L-Hu-96T	DL Develop	96T	EUR 725
Should the Human CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human CD5 Antigen Like Protein (CD5L) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
DLR-CD5L-Mu-48T	DL Develop	48T	EUR 566
Should the Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse CD5 Antigen Like Protein (CD5L) in samples from serum, plasma or other biological fluids.

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
DLR-CD5L-Mu-96T	DL Develop	96T	EUR 741
Should the Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse CD5 Antigen Like Protein (CD5L) in samples from serum, plasma or other biological fluids.

Human CD5 Antigen Like Protein (CD5L) ELISA Kit
RDR-CD5L-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human CD5 Antigen Like Protein (CD5L) ELISA Kit
RDR-CD5L-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
RDR-CD5L-Mu-48Tests	Reddot Biotech	48 Tests	EUR 603

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
RDR-CD5L-Mu-96Tests	Reddot Biotech	96 Tests	EUR 840

Human CD5 Antigen Like Protein (CD5L) ELISA Kit
RD-CD5L-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human CD5 Antigen Like Protein (CD5L) ELISA Kit
RD-CD5L-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
RD-CD5L-Mu-48Tests	Reddot Biotech	48 Tests	EUR 577

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
RD-CD5L-Mu-96Tests	Reddot Biotech	96 Tests	EUR 802

Rabbit CD5L ELISA Kit
ERTC0038	Abclonal	96Tests	EUR 521

CD5L Antibody
37478-100ul	SAB	100ul	EUR 252

CD5L antibody
38759-100ul	SAB	100ul	EUR 252

CD5L Antibody
1-CSB-PA004948ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000

CD5L Antibody
1-CSB-PA867465	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

CD5L Antibody
DF2304	Affbiotech	200ul	EUR 304
Description: CD5L antibody detects endogenous levels of total CD5L.

CD5L Antibody
1-CSB-PA563352	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CD5L Antibody
ABD2304	Lifescience Market	100 ug	EUR 438

Polyclonal AIM / CD5L Antibody (N-Terminus)
APR02297G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AIM / CD5L (N-Terminus). This antibody is tested and proven to work in the following applications:

Anti-CD5L antibody
STJ27979	St John's Laboratory	100 µl	EUR 277

Anti-CD5L antibody
STJ191677	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CD5L

CD5l protein
80R-4353	Fitzgerald	50 ug	EUR 349
Description: Purified Recombinant CD5l protein (His tagged)

CD5L siRNA
20-abx911054	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CD5L siRNA
20-abx911055	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CD5L
YF-PA10755	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to CD5L

anti-CD5L
YF-PA10756	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to CD5L

anti-CD5L
YF-PA27189	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CD5L

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human)
4-PAL300Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L)

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse)
4-PAL300Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L)

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat)
4-PAL300Ra01	Cloud-Clone	EUR 275.00 EUR 2958.00 EUR 727.00 EUR 350.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L)

CD5L Blocking Peptide
DF2304-BP	Affbiotech	1mg	EUR 195

CD5L cloning plasmid
CSB-CL004948HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1044 Sequence: atggctctgctattctccttgatccttgccatttgcaccagacctggattcctagcgtctccatctggagtgcggctggtggggggcctccaccgctgtgaagggcgggtggaggtggaacagaaaggccagtggggcaccgtgtgtgatgacggctgggacattaaggacgtgg Show more
Description: A cloning plasmid for the CD5L gene.

anti-CD5L (1C8)
LF-MA10050	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CD5L

CD5 Molecule Like (CD5L) Antibody
20-abx004754	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

CD5 Molecule Like (CD5L) Antibody
abx031276-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

CD5 Molecule Like (CD5L) Antibody
abx031276-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

CD5 Molecule Like (CD5L) Antibody
abx411856-01mg	Abbexa	0.1 mg	EUR 509
Shipped within 1 week.

CD5 Molecule Like (CD5L) Antibody
abx411857-01mg	Abbexa	0.1 mg	EUR 509
Shipped within 1 week.

CD5 Molecule Like (CD5L) Antibody
20-abx321419	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), APC
4-PAL300Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), Biotinylated
4-PAL300Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), Cy3
4-PAL300Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), FITC
4-PAL300Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), HRP
4-PAL300Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), PE
4-PAL300Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), APC
4-PAL300Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), Biotinylated
4-PAL300Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), Cy3
4-PAL300Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), FITC
4-PAL300Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), HRP
4-PAL300Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), PE
4-PAL300Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), APC
4-PAL300Ra01-APC	Cloud-Clone	EUR 388.00 EUR 3887.00 EUR 1065.00 EUR 501.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), Biotinylated
4-PAL300Ra01-Biotin	Cloud-Clone	EUR 343.00 EUR 2908.00 EUR 839.00 EUR 425.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), Cy3
4-PAL300Ra01-Cy3	Cloud-Clone	EUR 476.00 EUR 5141.00 EUR 1379.00 EUR 626.00 EUR 275.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), FITC
4-PAL300Ra01-FITC	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), HRP
4-PAL300Ra01-HRP	Cloud-Clone	EUR 353.00 EUR 3385.00 EUR 940.00 EUR 451.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), PE
4-PAL300Ra01-PE	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), APC-Cy7
4-PAL300Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), APC-Cy7
4-PAL300Mu01-APC-Cy7	Cloud-Clone	EUR 628.00 EUR 7258.00 EUR 1912.00 EUR 842.00 EUR 344.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), APC-Cy7
4-PAL300Ra01-APC-Cy7	Cloud-Clone	EUR 657.00 EUR 7654.00 EUR 2011.00 EUR 882.00 EUR 355.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx175765	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx212176	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx212250	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx102422	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx102423	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx102424	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx171658	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Human CD5L ELISA Kit
EHC0038	Abclonal	96Tests	EUR 521

Human CD5L ELISA Kit
ELA-E2547h	Lifescience Market	96 Tests	EUR 824

Goat CD5L ELISA Kit
EGTC0038	Abclonal	96Tests	EUR 521

Bovine CD5L ELISA Kit
EBC0038	Abclonal	96Tests	EUR 521

Canine CD5L ELISA Kit
ECC0038	Abclonal	96Tests	EUR 521

Chicken CD5L ELISA Kit
ECKC0038	Abclonal	96Tests	EUR 521

Anserini CD5L ELISA Kit
EAC0038	Abclonal	96Tests	EUR 521

CD5L ELISA KIT|Human
EF006297	Lifescience Market	96 Tests	EUR 689

Mouse CD5L shRNA Plasmid
20-abx969186	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CD5L shRNA Plasmid
20-abx950650	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CD5L ELISA Kit
EMC0038	Abclonal	96Tests	EUR 521

Rat CD5L ELISA Kit
ERC0038	Abclonal	96Tests	EUR 521

Sheep CD5L ELISA Kit
ESC0038	Abclonal	96Tests	EUR 521

Monkey CD5L ELISA Kit
EMKC0038	Abclonal	96Tests	EUR 521

Porcine CD5L ELISA Kit
EPC0038	Abclonal	96Tests	EUR 521

pCMV-SPORT6-CD5L Plasmid
PVT16345	Lifescience Market	2 ug	EUR 325

CD5L Recombinant Protein (Human)
RP006394	ABM	100 ug	Ask for price

CD5L Recombinant Protein (Rat)
RP194000	ABM	100 ug	Ask for price

CD5L Recombinant Protein (Mouse)
RP122657	ABM	100 ug	Ask for price

CD5 Antigen Like Protein (CD5L) Antibody (FITC)
20-abx271230	Abbexa	EUR 523.00 EUR 258.00 EUR 1581.00 EUR 732.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

CD5 Antigen Like Protein (CD5L) Antibody (FITC)
20-abx271282	Abbexa	EUR 537.00 EUR 272.00 EUR 1664.00 EUR 759.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

CD5 Antigen Like Protein (CD5L) Antibody (Biotin)
20-abx271496	Abbexa	EUR 495.00 EUR 258.00 EUR 1469.00 EUR 690.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

CD5 Antigen Like Protein (CD5L) Antibody (Biotin)
20-abx271548	Abbexa	EUR 509.00 EUR 258.00 EUR 1539.00 EUR 718.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

CD5 Antigen Like Protein (CD5L) Antibody (Biotin)
20-abx272488	Abbexa	EUR 481.00 EUR 244.00 EUR 1428.00 EUR 676.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Monoclonal CD5L Antibody (monoclonal) (M01), Clone: 1C8
AMM03348G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human CD5L (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1C8. This antibody is applicable in WB, IP, E

ELISA kit for Human CD5L
EK5657	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CD5L in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse CD5L
EK5658	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CD5L in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CD5L PicoKine ELISA Kit
EK1413	BosterBio	96 wells	EUR 425
Description: For quantitative detection of activated human CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse CD5L PicoKine ELISA Kit
EK1414	BosterBio	96 wells	EUR 425
Description: For quantitative detection of activated mouse CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Guinea Pig CD5L ELISA Kit
EGC0038	Abclonal	96Tests	EUR 521

Cd5l ORF Vector (Rat) (pORF)
ORF064668	ABM	1.0 ug DNA	EUR 506

CD5L ORF Vector (Human) (pORF)
ORF002132	ABM	1.0 ug DNA	EUR 95

Cd5l ORF Vector (Mouse) (pORF)
ORF040887	ABM	1.0 ug DNA	EUR 506

Recombinant Human CD5L/API6 Protein
RP00198	Abclonal	10 μg	EUR 155

CD5L ELISA Kit (Human) (OKCD02440)
OKCD02440	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Secreted protein that acts as a key regulator of lipid synthesis: mainly expressed by macrophages in lymphoid and inflammed tissues and regulates mechanisms in inflammatory responses, such as infection or atherosclerosis. Able to inhibit lipid droplet size in adipocytes. Following incorporation into mature adipocytes via CD36-mediated endocytosis, associates with cytosolic FASN, inhibiting fatty acid synthase activity and leading to lipolysis, the degradation of triacylglycerols into glycerol and free fatty acids (FFA). CD5L-induced lipolysis occurs with progression of obesity: participates in obesity-associated inflammation following recruitment of inflammatory macrophages into adipose tissues, a cause of insulin resistance and obesity-related metabolic disease. Regulation of intracellular lipids mediated by CD5L has a direct effect on transcription regulation mediated by nuclear receptors ROR-gamma (RORC). Acts as a key regulator of metabolic switch in T-helper Th17 cells. Regulates the expression of pro-inflammatory genes in Th17 cells by altering the lipid content and limiting synthesis of cholesterol ligand of RORC, the master transcription factor of Th17-cell differentiation. CD5L is mainly present in non-pathogenic Th17 cells, where it decreases the content of polyunsaturated fatty acyls (PUFA), affecting two metabolic proteins MSMO1 and CYP51A1, which synthesize ligands of RORC, limiting RORC activity and expression of pro-inflammatory genes. Participates in obesity-associated autoimmunity via its association with IgM, interfering with the binding of IgM to Fcalpha/mu receptor and enhancing the development of long-lived plasma cells that produce high-affinity IgG autoantibodies. Also acts as an inhibitor of apoptosis in macrophages: promotes macrophage survival from the apoptotic effects of oxidized lipids in case of atherosclerosis. Involved in early response to microbial infection against various pathogens by acting as a pattern recognition receptor and by promoting autophagy.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

CD5L ELISA Kit (Human) (OKBB00971)
OKBB00971	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CD5L ELISA Kit (Mouse) (OKBB00972)
OKBB00972	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CD5L ELISA Kit (Human) (OKBB01545)
OKBB01545	Aviva Systems Biology	96 Wells	EUR 570
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Cd5l ELISA Kit (Mouse) (OKBB01546)
OKBB01546	Aviva Systems Biology	96 Wells	EUR 570
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CD5L ELISA Kit (Mouse) (OKCD09297)
OKCD09297	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.136ng/mL

CD5L ELISA Kit (Mouse) (OKEH01656)
OKEH01656	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.63 pg/mL

CD5L sgRNA CRISPR Lentivector set (Human)
K0400201	ABM	3 x 1.0 ug	EUR 339

Cd5l sgRNA CRISPR Lentivector set (Rat)
K7473601	ABM	3 x 1.0 ug	EUR 339

Cd5l sgRNA CRISPR Lentivector set (Mouse)
K4335001	ABM	3 x 1.0 ug	EUR 339

Recombinant CD5 Antigen Like Protein (CD5L)
4-RPL300Hu01	Cloud-Clone	EUR 386.72 EUR 206.00 EUR 1175.20 EUR 458.40 EUR 816.80 EUR 322.00 EUR 2788.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O43866 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.3kDa Isoelectric Point: Inquire
Description: Recombinant Human CD5 Antigen Like Protein expressed in: E.coli

Recombinant CD5 Antigen Like Protein (CD5L)
4-RPL300Mu01	Cloud-Clone	EUR 444.06 EUR 222.00 EUR 1390.24 EUR 530.08 EUR 960.16 EUR 360.00 EUR 3325.60	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9QWK4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 63.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse CD5 Antigen Like Protein expressed in: E.coli

Recombinant CD5 Antigen Like Protein (CD5L)
4-RPL300Ra01	Cloud-Clone	EUR 490.66 EUR 234.00 EUR 1564.96 EUR 588.32 EUR 1076.64 EUR 391.00 EUR 3762.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q4KM75 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 63.8kDa Isoelectric Point: Inquire
Description: Recombinant Rat CD5 Antigen Like Protein expressed in: E.coli

Human CD5L/ CD5 antigen-like ELISA Kit
E0433Hu	Sunlong	1 Kit	EUR 605

Mouse Cd5l/ CD5 antigen-like ELISA Kit
E0255Mo	Sunlong	1 Kit	EUR 571

Mouse CD5 Antigen-Like (CD5L) ELISA Kit
20-abx153802	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human CD5 Antigen-Like (CD5L) ELISA Kit
20-abx151004	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse CD5 Antigen Like Protein (CD5L) Protein
20-abx065842	Abbexa	EUR 620.00 EUR 272.00 EUR 1873.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human CD5 Antigen Like Protein (CD5L) Protein
20-abx065843	Abbexa	EUR 551.00 EUR 244.00 EUR 1595.00 EUR 648.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat CD5 Antigen Like Protein (CD5L) Protein
20-abx065844	Abbexa	EUR 690.00 EUR 286.00 EUR 2110.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse CD5 Antigen-Like (CD5L) ELISA Kit
abx255110-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human CD5 Antigen-Like (CD5L) ELISA Kit
abx251573-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

CD5L Rabbit Polyclonal Antibody