CD5L Rabbit Polyclonal Antibody

CD5L Rabbit Polyclonal Antibody

CD5L Polyclonal Antibody
ES10519-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD5L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CD5L Polyclonal Antibody
ES10519-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD5L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rabbit Anti Cd5l (C-Terminal) Polyclonal Antibody
CPBT-65327RC	Creative Diagnostics	0.1 mg	EUR 710

CD5L Rabbit pAb
A6223-100ul	Abclonal	100 ul	EUR 308

CD5L Rabbit pAb
A6223-200ul	Abclonal	200 ul	EUR 459

CD5L Rabbit pAb
A6223-20ul	Abclonal	20 ul	EUR 183

CD5L Rabbit pAb
A6223-50ul	Abclonal	50 ul	EUR 223

Human CD5 Antigen Like Protein (CD5L) ELISA Kit
DLR-CD5L-Hu-48T	DL Develop	48T	EUR 554
Should the Human CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human CD5 Antigen Like Protein (CD5L) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human CD5 Antigen Like Protein (CD5L) ELISA Kit
DLR-CD5L-Hu-96T	DL Develop	96T	EUR 725
Should the Human CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human CD5 Antigen Like Protein (CD5L) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
DLR-CD5L-Mu-48T	DL Develop	48T	EUR 566
Should the Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse CD5 Antigen Like Protein (CD5L) in samples from serum, plasma or other biological fluids.

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
DLR-CD5L-Mu-96T	DL Develop	96T	EUR 741
Should the Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse CD5 Antigen Like Protein (CD5L) in samples from serum, plasma or other biological fluids.

Human CD5 Antigen Like Protein (CD5L) ELISA Kit
RDR-CD5L-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human CD5 Antigen Like Protein (CD5L) ELISA Kit
RDR-CD5L-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
RDR-CD5L-Mu-48Tests	Reddot Biotech	48 Tests	EUR 603

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
RDR-CD5L-Mu-96Tests	Reddot Biotech	96 Tests	EUR 840

Human CD5 Antigen Like Protein (CD5L) ELISA Kit
RD-CD5L-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human CD5 Antigen Like Protein (CD5L) ELISA Kit
RD-CD5L-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
RD-CD5L-Mu-48Tests	Reddot Biotech	48 Tests	EUR 577

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit
RD-CD5L-Mu-96Tests	Reddot Biotech	96 Tests	EUR 802

Rabbit CD5L ELISA Kit
ERTC0038	Abclonal	96Tests	EUR 521

CD5L Antibody
37478-100ul	SAB	100ul	EUR 252

CD5L antibody
38759-100ul	SAB	100ul	EUR 252

CD5L Antibody
1-CSB-PA004948ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000

CD5L Antibody
1-CSB-PA867465	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

CD5L Antibody
DF2304	Affbiotech	200ul	EUR 304
Description: CD5L antibody detects endogenous levels of total CD5L.

CD5L Antibody
1-CSB-PA563352	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CD5L Antibody
ABD2304	Lifescience Market	100 ug	EUR 438

Polyclonal AIM / CD5L Antibody (N-Terminus)
APR02297G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AIM / CD5L (N-Terminus). This antibody is tested and proven to work in the following applications:

Anti-CD5L antibody
STJ27979	St John's Laboratory	100 µl	EUR 277

Anti-CD5L antibody
STJ191677	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CD5L

CD5l protein
80R-4353	Fitzgerald	50 ug	EUR 349
Description: Purified Recombinant CD5l protein (His tagged)

CD5L siRNA
20-abx911054	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CD5L siRNA
20-abx911055	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CD5L
YF-PA10755	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to CD5L

anti-CD5L
YF-PA10756	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to CD5L

anti-CD5L
YF-PA27189	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CD5L

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human)
4-PAL300Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L)

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse)
4-PAL300Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L)

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat)
4-PAL300Ra01	Cloud-Clone	EUR 275.00 EUR 2958.00 EUR 727.00 EUR 350.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L)

CD5L Blocking Peptide
DF2304-BP	Affbiotech	1mg	EUR 195

CD5L cloning plasmid
CSB-CL004948HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1044 Sequence: atggctctgctattctccttgatccttgccatttgcaccagacctggattcctagcgtctccatctggagtgcggctggtggggggcctccaccgctgtgaagggcgggtggaggtggaacagaaaggccagtggggcaccgtgtgtgatgacggctgggacattaaggacgtgg Show more
Description: A cloning plasmid for the CD5L gene.

anti-CD5L (1C8)
LF-MA10050	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CD5L

CD5 Molecule Like (CD5L) Antibody
20-abx004754	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

CD5 Molecule Like (CD5L) Antibody
abx031276-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

CD5 Molecule Like (CD5L) Antibody
abx031276-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

CD5 Molecule Like (CD5L) Antibody
abx411856-01mg	Abbexa	0.1 mg	EUR 509
Shipped within 1 week.

CD5 Molecule Like (CD5L) Antibody
abx411857-01mg	Abbexa	0.1 mg	EUR 509
Shipped within 1 week.

CD5 Molecule Like (CD5L) Antibody
20-abx321419	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), APC
4-PAL300Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), Biotinylated
4-PAL300Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), Cy3
4-PAL300Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), FITC
4-PAL300Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), HRP
4-PAL300Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), PE
4-PAL300Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), APC
4-PAL300Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), Biotinylated
4-PAL300Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), Cy3
4-PAL300Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), FITC
4-PAL300Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), HRP
4-PAL300Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), PE
4-PAL300Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), APC
4-PAL300Ra01-APC	Cloud-Clone	EUR 388.00 EUR 3887.00 EUR 1065.00 EUR 501.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), Biotinylated
4-PAL300Ra01-Biotin	Cloud-Clone	EUR 343.00 EUR 2908.00 EUR 839.00 EUR 425.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), Cy3
4-PAL300Ra01-Cy3	Cloud-Clone	EUR 476.00 EUR 5141.00 EUR 1379.00 EUR 626.00 EUR 275.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), FITC
4-PAL300Ra01-FITC	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), HRP
4-PAL300Ra01-HRP	Cloud-Clone	EUR 353.00 EUR 3385.00 EUR 940.00 EUR 451.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), PE
4-PAL300Ra01-PE	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), APC-Cy7
4-PAL300Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Pro133~Arg256) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), APC-Cy7
4-PAL300Mu01-APC-Cy7	Cloud-Clone	EUR 628.00 EUR 7258.00 EUR 1912.00 EUR 842.00 EUR 344.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Glu22~Val352) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), APC-Cy7
4-PAL300Ra01-APC-Cy7	Cloud-Clone	EUR 657.00 EUR 7654.00 EUR 2011.00 EUR 882.00 EUR 355.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD5L (Leu11~Leu346) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx175765	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx212176	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx212250	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx102422	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx102423	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx102424	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CD5 Antigen Like Protein (CD5L) Antibody
20-abx171658	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Human CD5L ELISA Kit
EHC0038	Abclonal	96Tests	EUR 521

Human CD5L ELISA Kit
ELA-E2547h	Lifescience Market	96 Tests	EUR 824

Goat CD5L ELISA Kit
EGTC0038	Abclonal	96Tests	EUR 521

Bovine CD5L ELISA Kit
EBC0038	Abclonal	96Tests	EUR 521

Canine CD5L ELISA Kit
ECC0038	Abclonal	96Tests	EUR 521

Chicken CD5L ELISA Kit
ECKC0038	Abclonal	96Tests	EUR 521

Anserini CD5L ELISA Kit
EAC0038	Abclonal	96Tests	EUR 521

CD5L ELISA KIT|Human
EF006297	Lifescience Market	96 Tests	EUR 689

Mouse CD5L shRNA Plasmid
20-abx969186	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CD5L shRNA Plasmid
20-abx950650	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CD5L ELISA Kit
EMC0038	Abclonal	96Tests	EUR 521

Rat CD5L ELISA Kit
ERC0038	Abclonal	96Tests	EUR 521

Sheep CD5L ELISA Kit
ESC0038	Abclonal	96Tests	EUR 521

Monkey CD5L ELISA Kit
EMKC0038	Abclonal	96Tests	EUR 521

Porcine CD5L ELISA Kit
EPC0038	Abclonal	96Tests	EUR 521

pCMV-SPORT6-CD5L Plasmid
PVT16345	Lifescience Market	2 ug	EUR 325

CD5L Recombinant Protein (Human)
RP006394	ABM	100 ug	Ask for price

CD5L Recombinant Protein (Rat)
RP194000	ABM	100 ug	Ask for price

CD5L Recombinant Protein (Mouse)
RP122657	ABM	100 ug	Ask for price

CD5 Antigen Like Protein (CD5L) Antibody (FITC)
20-abx271230	Abbexa	EUR 523.00 EUR 258.00 EUR 1581.00 EUR 732.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

CD5 Antigen Like Protein (CD5L) Antibody (FITC)
20-abx271282	Abbexa	EUR 537.00 EUR 272.00 EUR 1664.00 EUR 759.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

CD5 Antigen Like Protein (CD5L) Antibody (Biotin)
20-abx271496	Abbexa	EUR 495.00 EUR 258.00 EUR 1469.00 EUR 690.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

CD5 Antigen Like Protein (CD5L) Antibody (Biotin)
20-abx271548	Abbexa	EUR 509.00 EUR 258.00 EUR 1539.00 EUR 718.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

CD5 Antigen Like Protein (CD5L) Antibody (Biotin)
20-abx272488	Abbexa	EUR 481.00 EUR 244.00 EUR 1428.00 EUR 676.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Monoclonal CD5L Antibody (monoclonal) (M01), Clone: 1C8
AMM03348G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human CD5L (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1C8. This antibody is applicable in WB, IP, E

ELISA kit for Human CD5L
EK5657	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CD5L in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse CD5L
EK5658	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CD5L in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CD5L PicoKine ELISA Kit
EK1413	BosterBio	96 wells	EUR 425
Description: For quantitative detection of activated human CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse CD5L PicoKine ELISA Kit
EK1414	BosterBio	96 wells	EUR 425
Description: For quantitative detection of activated mouse CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Guinea Pig CD5L ELISA Kit
EGC0038	Abclonal	96Tests	EUR 521

Cd5l ORF Vector (Rat) (pORF)
ORF064668	ABM	1.0 ug DNA	EUR 506

CD5L ORF Vector (Human) (pORF)
ORF002132	ABM	1.0 ug DNA	EUR 95

Cd5l ORF Vector (Mouse) (pORF)
ORF040887	ABM	1.0 ug DNA	EUR 506

Recombinant Human CD5L/API6 Protein
RP00198	Abclonal	10 μg	EUR 155

CD5L ELISA Kit (Human) (OKCD02440)
OKCD02440	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Secreted protein that acts as a key regulator of lipid synthesis: mainly expressed by macrophages in lymphoid and inflammed tissues and regulates mechanisms in inflammatory responses, such as infection or atherosclerosis. Able to inhibit lipid droplet size in adipocytes. Following incorporation into mature adipocytes via CD36-mediated endocytosis, associates with cytosolic FASN, inhibiting fatty acid synthase activity and leading to lipolysis, the degradation of triacylglycerols into glycerol and free fatty acids (FFA). CD5L-induced lipolysis occurs with progression of obesity: participates in obesity-associated inflammation following recruitment of inflammatory macrophages into adipose tissues, a cause of insulin resistance and obesity-related metabolic disease. Regulation of intracellular lipids mediated by CD5L has a direct effect on transcription regulation mediated by nuclear receptors ROR-gamma (RORC). Acts as a key regulator of metabolic switch in T-helper Th17 cells. Regulates the expression of pro-inflammatory genes in Th17 cells by altering the lipid content and limiting synthesis of cholesterol ligand of RORC, the master transcription factor of Th17-cell differentiation. CD5L is mainly present in non-pathogenic Th17 cells, where it decreases the content of polyunsaturated fatty acyls (PUFA), affecting two metabolic proteins MSMO1 and CYP51A1, which synthesize ligands of RORC, limiting RORC activity and expression of pro-inflammatory genes. Participates in obesity-associated autoimmunity via its association with IgM, interfering with the binding of IgM to Fcalpha/mu receptor and enhancing the development of long-lived plasma cells that produce high-affinity IgG autoantibodies. Also acts as an inhibitor of apoptosis in macrophages: promotes macrophage survival from the apoptotic effects of oxidized lipids in case of atherosclerosis. Involved in early response to microbial infection against various pathogens by acting as a pattern recognition receptor and by promoting autophagy.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

CD5L ELISA Kit (Human) (OKBB00971)
OKBB00971	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CD5L ELISA Kit (Mouse) (OKBB00972)
OKBB00972	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CD5L ELISA Kit (Human) (OKBB01545)
OKBB01545	Aviva Systems Biology	96 Wells	EUR 570
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Cd5l ELISA Kit (Mouse) (OKBB01546)
OKBB01546	Aviva Systems Biology	96 Wells	EUR 570
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CD5L ELISA Kit (Mouse) (OKCD09297)
OKCD09297	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.136ng/mL

CD5L ELISA Kit (Mouse) (OKEH01656)
OKEH01656	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.63 pg/mL

CD5L sgRNA CRISPR Lentivector set (Human)
K0400201	ABM	3 x 1.0 ug	EUR 339

Cd5l sgRNA CRISPR Lentivector set (Rat)
K7473601	ABM	3 x 1.0 ug	EUR 339

Cd5l sgRNA CRISPR Lentivector set (Mouse)
K4335001	ABM	3 x 1.0 ug	EUR 339

Recombinant CD5 Antigen Like Protein (CD5L)
4-RPL300Hu01	Cloud-Clone	EUR 386.72 EUR 206.00 EUR 1175.20 EUR 458.40 EUR 816.80 EUR 322.00 EUR 2788.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O43866 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.3kDa Isoelectric Point: Inquire
Description: Recombinant Human CD5 Antigen Like Protein expressed in: E.coli

Recombinant CD5 Antigen Like Protein (CD5L)
4-RPL300Mu01	Cloud-Clone	EUR 444.06 EUR 222.00 EUR 1390.24 EUR 530.08 EUR 960.16 EUR 360.00 EUR 3325.60	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9QWK4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 63.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse CD5 Antigen Like Protein expressed in: E.coli

Recombinant CD5 Antigen Like Protein (CD5L)
4-RPL300Ra01	Cloud-Clone	EUR 490.66 EUR 234.00 EUR 1564.96 EUR 588.32 EUR 1076.64 EUR 391.00 EUR 3762.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q4KM75 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 63.8kDa Isoelectric Point: Inquire
Description: Recombinant Rat CD5 Antigen Like Protein expressed in: E.coli

Human CD5L/ CD5 antigen-like ELISA Kit
E0433Hu	Sunlong	1 Kit	EUR 605

Mouse Cd5l/ CD5 antigen-like ELISA Kit
E0255Mo	Sunlong	1 Kit	EUR 571

Mouse CD5 Antigen-Like (CD5L) ELISA Kit
20-abx153802	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human CD5 Antigen-Like (CD5L) ELISA Kit
20-abx151004	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse CD5 Antigen Like Protein (CD5L) Protein
20-abx065842	Abbexa	EUR 620.00 EUR 272.00 EUR 1873.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human CD5 Antigen Like Protein (CD5L) Protein
20-abx065843	Abbexa	EUR 551.00 EUR 244.00 EUR 1595.00 EUR 648.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat CD5 Antigen Like Protein (CD5L) Protein
20-abx065844	Abbexa	EUR 690.00 EUR 286.00 EUR 2110.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse CD5 Antigen-Like (CD5L) ELISA Kit
abx255110-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human CD5 Antigen-Like (CD5L) ELISA Kit
abx251573-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human CD5L(CD5 antigen-like) ELISA Kit
EH2229	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: O43866 Alias: CD5L/AIM/API6/CT-2/SP-alpha/apoptosis inhibitor 6/CD5 antigen-like(scavenger receptor cysteine rich family)/CD5 molecule-like/IgM-associated peptide/PRO229/Spalpha/SP-ALPHA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.156--10 ng/ml

Human CD5 Antigen-like(CD5L) ELISA Kit
CSB-E13423h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CD5 Antigen-like (CD5L) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human CD5 Antigen-like(CD5L) ELISA Kit
1-CSB-E13423h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CD5 Antigen-like(CD5L) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human CD5 Antigen-Like (CD5L) ELISA Kit
abx576076-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Mouse CD5l( CD5 antigen-like) ELISA Kit
EM0762	FN Test	96T	EUR 567.6
Detection range: 31.2-2000 pg/ml Uniprot ID: Q9QWK4 Alias: CD5l/AIM/API6/CT-2/SP-alpha/apoptosis inhibitor 6/CD5 antigen-like(scavenger receptor cysteine rich family)/CD5 molecule-like/IgM-associated peptide/PRO229/Spalpha/SP-ALPHA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml

Human CD5 antigen- like, CD5L ELISA KIT
ELI-34065h	Lifescience Market	96 Tests	EUR 824

Mouse CD5 antigen- like, Cd5l ELISA KIT
ELI-50522m	Lifescience Market	96 Tests	EUR 865

CD5L sgRNA CRISPR Lentivector (Human) (Target 1)
K0400202	ABM	1.0 ug DNA	EUR 154

CD5L sgRNA CRISPR Lentivector (Human) (Target 2)
K0400203	ABM	1.0 ug DNA	EUR 154

CD5L sgRNA CRISPR Lentivector (Human) (Target 3)
K0400204	ABM	1.0 ug DNA	EUR 154

Cd5l sgRNA CRISPR Lentivector (Rat) (Target 1)
K7473602	ABM	1.0 ug DNA	EUR 154

Cd5l sgRNA CRISPR Lentivector (Rat) (Target 2)
K7473603	ABM	1.0 ug DNA	EUR 154

Cd5l sgRNA CRISPR Lentivector (Rat) (Target 3)
K7473604	ABM	1.0 ug DNA	EUR 154

Cd5l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4335002	ABM	1.0 ug DNA	EUR 154

Cd5l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4335003	ABM	1.0 ug DNA	EUR 154

Cd5l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4335004	ABM	1.0 ug DNA	EUR 154

CD5L CD5 Molecule-Like Mouse Recombinant Protein
PROTQ9QWK4	BosterBio	Regular: 10ug	EUR 317
Description: CD5L produced in Sf9 Insect cells is a single,glycosylated polypeptide chain containing 339 amino acids (22-352a.a.) andhaving a molecular mass of 37.6 kDa. (Molecular size on SDS-PAGE will appear atapproximately 40-57kDa).;CD5L is expressed with an 8 amino acid His tag atC-Terminus and purified by proprietary chromatographic techniques.

CD5L CD5 Molecule-Like Human Recombinant Protein
PROTO43866	BosterBio	Regular: 10ug	EUR 317
Description: CD5L Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (a.a 20-347) containing 337 amino acids including a 9 a.a N-terminal His tag. The total molecular mass is 37.2kDa (calculated).

CD5L Protein Vector (Mouse) (pPB-C-His)
PV163546	ABM	500 ng	EUR 603

CD5L Protein Vector (Mouse) (pPB-N-His)
PV163547	ABM	500 ng	EUR 603

CD5L Protein Vector (Mouse) (pPM-C-HA)
PV163548	ABM	500 ng	EUR 603

CD5L Protein Vector (Mouse) (pPM-C-His)
PV163549	ABM	500 ng	EUR 603

CD5L Protein Vector (Rat) (pPB-C-His)
PV258670	ABM	500 ng	EUR 603

CD5L Protein Vector (Rat) (pPB-N-His)
PV258671	ABM	500 ng	EUR 603

CD5L Protein Vector (Rat) (pPM-C-HA)
PV258672	ABM	500 ng	EUR 603

CD5L Protein Vector (Rat) (pPM-C-His)
PV258673	ABM	500 ng	EUR 603

CD5L Protein Vector (Human) (pPB-C-His)
PV008525	ABM	500 ng	EUR 329

CD5L Protein Vector (Human) (pPB-N-His)
PV008526	ABM	500 ng	EUR 329

CD5L Protein Vector (Human) (pPM-C-HA)
PV008527	ABM	500 ng	EUR 329

CD5L Protein Vector (Human) (pPM-C-His)
PV008528	ABM	500 ng	EUR 329

Recombinant Human CD5L Protein, His, E.coli-10ug
QP11341-HIS-EC-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human CD5L Protein, His, E.coli-1mg
QP11341-HIS-EC-1mg	EnQuireBio	1mg	EUR 5251

Recombinant Human CD5L Protein, His, E.coli-2ug
QP11341-HIS-EC-2ug	EnQuireBio	2ug	EUR 155

Recombinant Mouse CD5L Protein, His, Insect-10ug
QP11342-10ug	EnQuireBio	10ug	EUR 201

Recombinant Mouse CD5L Protein, His, Insect-1mg
QP11342-1mg	EnQuireBio	1mg	EUR 5251

Recombinant Mouse CD5L Protein, His, Insect-2ug
QP11342-2ug	EnQuireBio	2ug	EUR 155

Cd5l 3'UTR GFP Stable Cell Line
TU153518	ABM	1.0 ml	Ask for price

Cd5l 3'UTR Luciferase Stable Cell Line
TU103518	ABM	1.0 ml	Ask for price

Cd5l 3'UTR Luciferase Stable Cell Line
TU201991	ABM	1.0 ml	Ask for price

Cd5l 3'UTR GFP Stable Cell Line
TU251991	ABM	1.0 ml	Ask for price

CD5L 3'UTR GFP Stable Cell Line
TU053869	ABM	1.0 ml	EUR 1394

CD5L 3'UTR Luciferase Stable Cell Line
TU003869	ABM	1.0 ml	EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody
ABP57581-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG14L Rabbit Polyclonal Antibody
ABP57583-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

ATG14L Rabbit Polyclonal Antibody
ABP57583-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG14L Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

NBR1 Rabbit Polyclonal Antibody
ABP57585-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57585-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

NBR1 Rabbit Polyclonal Antibody
ABP57586-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NBR1 Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

WIPI2 Rabbit Polyclonal Antibody
ABP57587-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

WIPI2 Rabbit Polyclonal Antibody
ABP57587-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

WIPI2 Rabbit Polyclonal Antibody
ABP57587-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of WIPI2 Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

FAK Rabbit Polyclonal Antibody
ABP57588-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

FAK Rabbit Polyclonal Antibody
ABP57588-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

FAK Rabbit Polyclonal Antibody
ABP57588-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of FAK Applications tips:
Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

Gab1 Rabbit Polyclonal Antibody
ABP57589-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

Gab1 Rabbit Polyclonal Antibody
ABP57589-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

Gab1 Rabbit Polyclonal Antibody
ABP57589-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Gab1 Applications tips:
Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

ERK1 Rabbit Polyclonal Antibody
ABP57590-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

ERK1 Rabbit Polyclonal Antibody
ABP57590-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

ERK1 Rabbit Polyclonal Antibody
ABP57590-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ERK1 Applications tips:
Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul