CD5L Rabbit Polyclonal Antibody

CD5L Rabbit Polyclonal Antibody

CD5L Polyclonal Antibody

ES10519-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD5L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CD5L Polyclonal Antibody

ES10519-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD5L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rabbit Anti Cd5l (C-Terminal) Polyclonal Antibody

CPBT-65327RC 0.1 mg
EUR 710

CD5L Rabbit pAb

A6223-100ul 100 ul
EUR 308

CD5L Rabbit pAb

A6223-200ul 200 ul
EUR 459

CD5L Rabbit pAb

A6223-20ul 20 ul
EUR 183

CD5L Rabbit pAb

A6223-50ul 50 ul
EUR 223

Human CD5 Antigen Like Protein (CD5L) ELISA Kit

DLR-CD5L-Hu-48T 48T
EUR 554
  • Should the Human CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human CD5 Antigen Like Protein (CD5L) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human CD5 Antigen Like Protein (CD5L) ELISA Kit

DLR-CD5L-Hu-96T 96T
EUR 725
  • Should the Human CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human CD5 Antigen Like Protein (CD5L) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit

DLR-CD5L-Mu-48T 48T
EUR 566
  • Should the Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse CD5 Antigen Like Protein (CD5L) in samples from serum, plasma or other biological fluids.

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit

DLR-CD5L-Mu-96T 96T
EUR 741
  • Should the Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse CD5 Antigen Like Protein (CD5L) in samples from serum, plasma or other biological fluids.

Human CD5 Antigen Like Protein (CD5L) ELISA Kit

RDR-CD5L-Hu-48Tests 48 Tests
EUR 589

Human CD5 Antigen Like Protein (CD5L) ELISA Kit

RDR-CD5L-Hu-96Tests 96 Tests
EUR 820

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit

RDR-CD5L-Mu-48Tests 48 Tests
EUR 603

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit

RDR-CD5L-Mu-96Tests 96 Tests
EUR 840

Human CD5 Antigen Like Protein (CD5L) ELISA Kit

RD-CD5L-Hu-48Tests 48 Tests
EUR 563

Human CD5 Antigen Like Protein (CD5L) ELISA Kit

RD-CD5L-Hu-96Tests 96 Tests
EUR 783

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit

RD-CD5L-Mu-48Tests 48 Tests
EUR 577

Mouse CD5 Antigen Like Protein (CD5L) ELISA Kit

RD-CD5L-Mu-96Tests 96 Tests
EUR 802

Rabbit CD5L ELISA Kit

ERTC0038 96Tests
EUR 521

CD5L Antibody

37478-100ul 100ul
EUR 252

CD5L antibody

38759-100ul 100ul
EUR 252

CD5L Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000

CD5L Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

CD5L Antibody

DF2304 200ul
EUR 304
Description: CD5L antibody detects endogenous levels of total CD5L.

CD5L Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD5L. Recognizes CD5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CD5L Antibody

ABD2304 100 ug
EUR 438

Polyclonal AIM / CD5L Antibody (N-Terminus)

APR02297G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AIM / CD5L (N-Terminus). This antibody is tested and proven to work in the following applications:

Anti-CD5L antibody

STJ27979 100 µl
EUR 277

Anti-CD5L antibody

STJ191677 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CD5L

CD5l protein

80R-4353 50 ug
EUR 349
Description: Purified Recombinant CD5l protein (His tagged)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA10755 50 ul
EUR 363
Description: Mouse polyclonal to CD5L


YF-PA10756 100 ug
EUR 403
Description: Rabbit polyclonal to CD5L


YF-PA27189 50 ug
EUR 363
Description: Mouse polyclonal to CD5L

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L)

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse)

  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L)

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat)

  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L)

CD5L Blocking Peptide

DF2304-BP 1mg
EUR 195

CD5L cloning plasmid

CSB-CL004948HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1044
  • Sequence: atggctctgctattctccttgatccttgccatttgcaccagacctggattcctagcgtctccatctggagtgcggctggtggggggcctccaccgctgtgaagggcgggtggaggtggaacagaaaggccagtggggcaccgtgtgtgatgacggctgggacattaaggacgtgg
  • Show more
Description: A cloning plasmid for the CD5L gene.

anti-CD5L (1C8)

LF-MA10050 100 ug
EUR 363
Description: Mouse monoclonal to CD5L

CD5 Molecule Like (CD5L) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

CD5 Molecule Like (CD5L) Antibody

abx031276-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CD5 Molecule Like (CD5L) Antibody

abx031276-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CD5 Molecule Like (CD5L) Antibody

abx411856-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

CD5 Molecule Like (CD5L) Antibody

abx411857-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

CD5 Molecule Like (CD5L) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), APC

  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), Cy3

  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), FITC

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), HRP

  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), PE

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), APC

  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), Biotinylated

  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with Biotin.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), Cy3

  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with Cy3.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), FITC

  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with FITC.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), HRP

  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with HRP.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), PE

  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with PE.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Human), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Pro133~Arg256)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Glu22~Val352)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7.

CD5 Antigen Like Protein (CD5L) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD5L (Leu11~Leu346)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat CD5 Antigen Like Protein (CD5L). This antibody is labeled with APC-Cy7.

CD5 Antigen Like Protein (CD5L) Antibody

  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

CD5 Antigen Like Protein (CD5L) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CD5 Antigen Like Protein (CD5L) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CD5 Antigen Like Protein (CD5L) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CD5 Antigen Like Protein (CD5L) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CD5 Antigen Like Protein (CD5L) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CD5 Antigen Like Protein (CD5L) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human CD5L ELISA Kit

EHC0038 96Tests
EUR 521

Human CD5L ELISA Kit

ELA-E2547h 96 Tests
EUR 824


EGTC0038 96Tests
EUR 521

Bovine CD5L ELISA Kit

EBC0038 96Tests
EUR 521

Canine CD5L ELISA Kit

ECC0038 96Tests
EUR 521

Chicken CD5L ELISA Kit

ECKC0038 96Tests
EUR 521

Anserini CD5L ELISA Kit

EAC0038 96Tests
EUR 521


EF006297 96 Tests
EUR 689

Mouse CD5L shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CD5L shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CD5L ELISA Kit

EMC0038 96Tests
EUR 521


ERC0038 96Tests
EUR 521

Sheep CD5L ELISA Kit

ESC0038 96Tests
EUR 521

Monkey CD5L ELISA Kit

EMKC0038 96Tests
EUR 521

Porcine CD5L ELISA Kit

EPC0038 96Tests
EUR 521

pCMV-SPORT6-CD5L Plasmid

PVT16345 2 ug
EUR 325

CD5L Recombinant Protein (Human)

RP006394 100 ug Ask for price

CD5L Recombinant Protein (Rat)

RP194000 100 ug Ask for price

CD5L Recombinant Protein (Mouse)

RP122657 100 ug Ask for price

CD5 Antigen Like Protein (CD5L) Antibody (FITC)

  • EUR 523.00
  • EUR 258.00
  • EUR 1581.00
  • EUR 732.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CD5 Antigen Like Protein (CD5L) Antibody (FITC)

  • EUR 537.00
  • EUR 272.00
  • EUR 1664.00
  • EUR 759.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CD5 Antigen Like Protein (CD5L) Antibody (Biotin)

  • EUR 495.00
  • EUR 258.00
  • EUR 1469.00
  • EUR 690.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CD5 Antigen Like Protein (CD5L) Antibody (Biotin)

  • EUR 509.00
  • EUR 258.00
  • EUR 1539.00
  • EUR 718.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CD5 Antigen Like Protein (CD5L) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1428.00
  • EUR 676.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Monoclonal CD5L Antibody (monoclonal) (M01), Clone: 1C8

AMM03348G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CD5L (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1C8. This antibody is applicable in WB, IP, E

ELISA kit for Human CD5L

EK5657 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CD5L in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse CD5L

EK5658 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CD5L in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CD5L PicoKine ELISA Kit

EK1413 96 wells
EUR 425
Description: For quantitative detection of activated human CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse CD5L PicoKine ELISA Kit

EK1414 96 wells
EUR 425
Description: For quantitative detection of activated mouse CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Guinea Pig CD5L ELISA Kit

EGC0038 96Tests
EUR 521

Cd5l ORF Vector (Rat) (pORF)

ORF064668 1.0 ug DNA
EUR 506

CD5L ORF Vector (Human) (pORF)

ORF002132 1.0 ug DNA
EUR 95

Cd5l ORF Vector (Mouse) (pORF)

ORF040887 1.0 ug DNA
EUR 506

Recombinant Human CD5L/API6 Protein

RP00198 10 μg
EUR 155

CD5L ELISA Kit (Human) (OKCD02440)

OKCD02440 96 Wells
EUR 909
Description: Description of target: Secreted protein that acts as a key regulator of lipid synthesis: mainly expressed by macrophages in lymphoid and inflammed tissues and regulates mechanisms in inflammatory responses, such as infection or atherosclerosis. Able to inhibit lipid droplet size in adipocytes. Following incorporation into mature adipocytes via CD36-mediated endocytosis, associates with cytosolic FASN, inhibiting fatty acid synthase activity and leading to lipolysis, the degradation of triacylglycerols into glycerol and free fatty acids (FFA). CD5L-induced lipolysis occurs with progression of obesity: participates in obesity-associated inflammation following recruitment of inflammatory macrophages into adipose tissues, a cause of insulin resistance and obesity-related metabolic disease. Regulation of intracellular lipids mediated by CD5L has a direct effect on transcription regulation mediated by nuclear receptors ROR-gamma (RORC). Acts as a key regulator of metabolic switch in T-helper Th17 cells. Regulates the expression of pro-inflammatory genes in Th17 cells by altering the lipid content and limiting synthesis of cholesterol ligand of RORC, the master transcription factor of Th17-cell differentiation. CD5L is mainly present in non-pathogenic Th17 cells, where it decreases the content of polyunsaturated fatty acyls (PUFA), affecting two metabolic proteins MSMO1 and CYP51A1, which synthesize ligands of RORC, limiting RORC activity and expression of pro-inflammatory genes. Participates in obesity-associated autoimmunity via its association with IgM, interfering with the binding of IgM to Fcalpha/mu receptor and enhancing the development of long-lived plasma cells that produce high-affinity IgG autoantibodies. Also acts as an inhibitor of apoptosis in macrophages: promotes macrophage survival from the apoptotic effects of oxidized lipids in case of atherosclerosis. Involved in early response to microbial infection against various pathogens by acting as a pattern recognition receptor and by promoting autophagy.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

CD5L ELISA Kit (Human) (OKBB00971)

OKBB00971 96 Wells
EUR 505
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CD5L ELISA Kit (Mouse) (OKBB00972)

OKBB00972 96 Wells
EUR 505
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CD5L ELISA Kit (Human) (OKBB01545)

OKBB01545 96 Wells
EUR 570
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Cd5l ELISA Kit (Mouse) (OKBB01546)

OKBB01546 96 Wells
EUR 570
Description: Description of target: CD5 antigen-like, also known as Sp alpha and AIM, is a protein that in humans is encoded by the CD5L gene. It is mapped to 1q21-q23 by fluorescence in situ hybridization. It is found that Aim expression is induced in mouse macrophages in response to loading with highly oxidized low density lipoprotein (oxLDL), and that Aim is expressed in foam cells within atherosclerotic lesions. Both the expression of Aim in lesions and its induction by oxLDL require Lxr /Rxr heterodimers. Aim-null macrophages are highly susceptible to oxLDL-induced apoptosis in vitro and undergo accelerated apoptosis in atherosclerotic lesions in vivo. Double knockout of Aim and Ldlr reduce atherosclerotic lesions. Therefore, it is concluded that AIM expression protects macrophages from apoptosis within atherosclerotic lesions, promoting early lesion development.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CD5L ELISA Kit (Mouse) (OKCD09297)

OKCD09297 96 Wells
EUR 936
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.136ng/mL

CD5L ELISA Kit (Mouse) (OKEH01656)

OKEH01656 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.63 pg/mL

CD5L sgRNA CRISPR Lentivector set (Human)

K0400201 3 x 1.0 ug
EUR 339

Cd5l sgRNA CRISPR Lentivector set (Rat)

K7473601 3 x 1.0 ug
EUR 339

Cd5l sgRNA CRISPR Lentivector set (Mouse)

K4335001 3 x 1.0 ug
EUR 339

Recombinant CD5 Antigen Like Protein (CD5L)

  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O43866
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human CD5 Antigen Like Protein expressed in: E.coli

Recombinant CD5 Antigen Like Protein (CD5L)

  • EUR 444.06
  • EUR 222.00
  • EUR 1390.24
  • EUR 530.08
  • EUR 960.16
  • EUR 360.00
  • EUR 3325.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9QWK4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 63.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse CD5 Antigen Like Protein expressed in: E.coli

Recombinant CD5 Antigen Like Protein (CD5L)

  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q4KM75
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 63.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat CD5 Antigen Like Protein expressed in: E.coli

Human CD5L/ CD5 antigen-like ELISA Kit

E0433Hu 1 Kit
EUR 605

Mouse Cd5l/ CD5 antigen-like ELISA Kit

E0255Mo 1 Kit
EUR 571

Mouse CD5 Antigen-Like (CD5L) ELISA Kit

  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human CD5 Antigen-Like (CD5L) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse CD5 Antigen Like Protein (CD5L) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1873.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human CD5 Antigen Like Protein (CD5L) Protein

  • EUR 551.00
  • EUR 244.00
  • EUR 1595.00
  • EUR 648.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat CD5 Antigen Like Protein (CD5L) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse CD5 Antigen-Like (CD5L) ELISA Kit

abx255110-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human CD5 Antigen-Like (CD5L) ELISA Kit

abx251573-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

CD5L Rabbit Polyclonal Antibody