CDC42 Rabbit Polyclonal Antibody

CDC42 Rabbit Polyclonal Antibody

CDC42 Polyclonal Antibody

ABP58078-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CDC42 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of CDC42 from Human, Mouse, Rat. This CDC42 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDC42 protein at amino acid sequence of 80-160

CDC42 Polyclonal Antibody

ES10520-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CDC42 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDC42 Polyclonal Antibody

ES10520-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CDC42 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDC42 Rabbit pAb

A15657-100ul 100 ul
EUR 308

CDC42 Rabbit pAb

A15657-200ul 200 ul
EUR 459

CDC42 Rabbit pAb

A15657-20ul 20 ul
EUR 183

CDC42 Rabbit pAb

A15657-50ul 50 ul
EUR 223

CDC42 Rabbit pAb

A1188-100ul 100 ul
EUR 308

CDC42 Rabbit pAb

A1188-200ul 200 ul
EUR 459

CDC42 Rabbit pAb

A1188-20ul 20 ul
EUR 183

CDC42 Rabbit pAb

A1188-50ul 50 ul
EUR 223

CDC42 Rabbit mAb

A19028-100ul 100 ul
EUR 410

CDC42 Rabbit mAb

A19028-200ul 200 ul
EUR 571

CDC42 Rabbit mAb

A19028-20ul 20 ul
EUR 221

CDC42 Rabbit mAb

A19028-50ul 50 ul
EUR 287

Polyclonal CDC42 Antibody (Center)

APR05822G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDC42 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal cdc42/Rac Antibody

APR00020G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human cdc42/Rac . This antibody is tested and proven to work in the following applications:

Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit

DLR-CDC42-Hu-48T 48T
EUR 517
  • Should the Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cell Division Cycle Protein 42 (CDC42) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit

DLR-CDC42-Hu-96T 96T
EUR 673
  • Should the Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cell Division Cycle Protein 42 (CDC42) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit

RDR-CDC42-Hu-48Tests 48 Tests
EUR 544

Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit

RDR-CDC42-Hu-96Tests 96 Tests
EUR 756

Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit

RD-CDC42-Hu-48Tests 48 Tests
EUR 521

Human Cell Division Cycle Protein 42 (CDC42) ELISA Kit

RD-CDC42-Hu-96Tests 96 Tests
EUR 723

Anti-CDC42 Rabbit Monoclonal Antibody

M00119 100ug/vial
EUR 397
Description: Rabbit Monoclonal CDC42 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

CDC42 Polyclonal Antibody, HRP Conjugated

A62235 100 µg
EUR 570.55
Description: fast delivery possible

CDC42 Polyclonal Antibody, FITC Conjugated

A62236 100 µg
EUR 570.55
Description: reagents widely cited

CDC42 Polyclonal Antibody, Biotin Conjugated

A62237 100 µg
EUR 570.55
Description: Ask the seller for details

CDC42 Antibody

24863-100ul 100ul
EUR 390

CDC42 antibody

70R-16304 50 ul
EUR 435
Description: Rabbit polyclonal CDC42 antibody

CDC42 antibody

70R-10438 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CDC42 antibody

CDC42 antibody

70R-13909 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CDC42 antibody

CDC42 Antibody

35353-100ul 100ul
EUR 390

CDC42 Antibody

32214-100ul 100ul
EUR 252

CDC42 antibody

10R-10300 100 ug
EUR 435
Description: Mouse monoclonal CDC42 antibody

CDC42 antibody

10R-10301 100 ug
EUR 435
Description: Mouse monoclonal CDC42 antibody

CDC42 Antibody

49282-100ul 100ul
EUR 333

CDC42 Antibody

49282-50ul 50ul
EUR 239

CDC42 Antibody

1-CSB-PA005008DA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC42. Recognizes CDC42 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

CDC42 Antibody

1-CSB-PA005008GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDC42. Recognizes CDC42 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CDC42 Antibody

1-CSB-PA620509
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC42. Recognizes CDC42 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

CDC42 Antibody

DF6322 200ul
EUR 304
Description: CDC42 Antibody detects endogenous levels of total CDC42.

CDC42 Antibody

DF2308 200ul
EUR 304
Description: CDC42 antibody detects endogenous levels of total CDC42.

CDC42 antibody

70R-49516 100 ul
EUR 244
Description: Purified Polyclonal CDC42 antibody

CDC42 antibody

70R-32475 100 ug
EUR 327
Description: Rabbit polyclonal CDC42 antibody

CDC42 Antibody

ABD2308 100 ug
EUR 438

CDC42 Antibody

ABD6322 100 ug
EUR 438

Rac1/2/3/CDC42 Polyclonal Antibody

ABP52301-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Rac1/2/3/CDC42 around the non-phosphorylation site of S71
  • Applications tips:
Description: A polyclonal antibody for detection of Rac1/2/3/CDC42 from Human, Mouse, Rat. This Rac1/2/3/CDC42 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Rac1/2/3/CDC42 around the non-phosphorylation site of S71

Rac1/2/3/CDC42 Polyclonal Antibody

ABP52301-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Rac1/2/3/CDC42 around the non-phosphorylation site of S71
  • Applications tips:
Description: A polyclonal antibody for detection of Rac1/2/3/CDC42 from Human, Mouse, Rat. This Rac1/2/3/CDC42 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Rac1/2/3/CDC42 around the non-phosphorylation site of S71

Rac1/2/3/CDC42 Polyclonal Antibody

ABP52301-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Rac1/2/3/CDC42 around the non-phosphorylation site of S71
  • Applications tips:
Description: A polyclonal antibody for detection of Rac1/2/3/CDC42 from Human, Mouse, Rat. This Rac1/2/3/CDC42 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Rac1/2/3/CDC42 around the non-phosphorylation site of S71

Rac1/2/3/CDC42 Polyclonal Antibody

ES3300-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Rac1/2/3/CDC42 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Rac1/2/3/CDC42 Polyclonal Antibody

ES3300-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Rac1/2/3/CDC42 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

cdc42/Rac Antibody

3080-100
EUR 338

cdc42/Rac Antibody

3080-30T
EUR 146

Anti-CDC42 Antibody

A00119 100ug/vial
EUR 334

CDC42 Conjugated Antibody

C49282 100ul
EUR 397

CDC42 Conjugated Antibody

C32214 100ul
EUR 397

Rac1/cdc42 Antibody

AF7828 200ul
EUR 376
Description: Rac1/cdc42 Antibody detects endogenous levels of Rac1/cdc42.

anti- CDC42 antibody

FNab01530 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: cell division cycle 42 (GTP binding protein, 25kDa)
  • Uniprot ID: P60953
  • Gene ID: 998
  • Research Area: Immunology, Signal Transduction, Cell Division and Proliferation
Description: Antibody raised against CDC42

Anti-CDC42 Antibody

PA1366 100ug/vial
EUR 334

Anti-CDC42 antibody

PAab01530 100 ug
EUR 386

Anti-CDC42 antibody

STJ118117 100 µl
EUR 277

Anti-CDC42 antibody

STJ29840 100 µl
EUR 277
Description: The protein encoded by this gene is a small GTPase of the Rho-subfamily, which regulates signaling pathways that control diverse cellular functions including cell morphology, migration, endocytosis and cell cycle progression. This protein is highly similar to Saccharomyces cerevisiae Cdc 42, and is able to complement the yeast cdc42-1 mutant. The product of oncogene Dbl was reported to specifically catalyze the dissociation of GDP from this protein. This protein could regulate actin polymerization through its direct binding to Neural Wiskott-Aldrich syndrome protein (N-WASP), which subsequently activates Arp2/3 complex. Alternative splicing of this gene results in multiple transcript variants. Pseudogenes of this gene have been identified on chromosomes 3, 4, 5, 7, 8 and 20.

Anti-CDC42 antibody

STJ191678 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CDC42

Rabbit Anti-CDC42 monoclonal antibody, clone KK197-15

CABT-L846 100 ul
EUR 777

Anti-Phospho-Rac1/Cdc42 (Ser71) Rabbit Monoclonal Antibody

P00119 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-Rac1/Cdc42 (Ser71) Antibody. Validated in WB and tested in Human.

CDC42/RHO/RAC Antibody

36743-100ul 100ul
EUR 252

CDC42 Antibody, HRP conjugated

1-CSB-PA005008DB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC42. Recognizes CDC42 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CDC42 Antibody, FITC conjugated

1-CSB-PA005008DC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC42. Recognizes CDC42 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CDC42 Antibody, Biotin conjugated

1-CSB-PA005008DD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC42. Recognizes CDC42 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Rac1/CDC42 Antibody

A03252 100ul
EUR 397
Description: Rabbit Polyclonal Rac1/CDC42 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

CDC42 recombinant monoclonal antibody

A5689 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human CDC42 for WB, IHC,ELISA

CDC42 protein

30R-3026 200 ug
EUR 354
Description: Purified recombinant CDC42 protein

CDC42 siRNA

20-abx900943
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC42 siRNA

20-abx911162
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC42 siRNA

20-abx911163
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC42, Human

LF-P0143 0.2 mg
EUR 303
Description: CDC42, Human protein

anti-CDC42

YF-PA10844 100 ug
EUR 403
Description: Rabbit polyclonal to CDC42

Polyclonal Cdc42-binding kinase alpha Antibody (N-Term)

APR15361G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Cdc42-binding kinase alpha (N-Term). This antibody is tested and proven to work in the following applications:

CDC42 binding protein kinase beta (CDC42BPB) polyclonal antibody

ABP-PAB-02396 100 ug Ask for price
    • Product line: Kinases
    • Brand:

Cdc42 G15A Agarose Beads (Active Cdc42-GEF)

STA-433 800 ?g
EUR 699
Description: Cdc42 G15A Agarose Beads selectively pull down the active form of Cdc42 GEF. Beads are colored to allow for a visual check. 800 µg.

Cell Division Cycle Protein 42 (CDC42) Polyclonal Antibody (Human)

4-PAE614Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDC42 (Met1~Cys188)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cell Division Cycle Protein 42 (CDC42)

Rac1/cdc42 (Phospho-Tyr64) Antibody

13177-100ul 100ul
EUR 252

Rac1/cdc42 (Phospho-Tyr64) Antibody

13177-50ul 50ul
EUR 187

Rac1+Cdc42(Phospho-Ser71) Antibody

13425-100ul 100ul
EUR 333

Rac1+Cdc42(Phospho-Ser71) Antibody

13425-50ul 50ul
EUR 239

Rac1/2/3/CDC42 Antibody

44403-100ul 100ul
EUR 252

Rac1/2/3/CDC42 Antibody

44403-50ul 50ul
EUR 187

RAC1/RAC2/RAC3/CDC42 Antibody

1-CSB-PA003908
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAC1/RAC2/RAC3/CDC42. Recognizes RAC1/RAC2/RAC3/CDC42 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Rac1 / 2 / 3 / CDC42 Antibody

20-abx218145
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospho-Rac1/cdc42 (Ser71) Antibody

AF2393 200ul
EUR 304
Description: Phospho-Rac1/cdc42 (Ser71) Antibody detects endogenous levels of Rac1/cdc42.

Phospho-Rac1/cdc42 (Tyr64) Antibody

AF7328 200ul
EUR 376
Description: Phospho-Rac1/cdc42 (Tyr64) Antibody detects endogenous levels of Rac1/cdc42 only when phosphorylated at Tyr64.

CDC42/RHO/RAC Conjugated Antibody

C36743 100ul
EUR 397

RAC1 / RAC2 / RAC3 / CDC42 Antibody

20-abx328546
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cdc42-binding kinase alpha Antibody

abx431727-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Rac1/2/3/CDC42 Antibody

AF9178 200ul
EUR 304
Description: Rac1/2/3/CDC42 Antibody detects endogenous levels of total Rac1/2/3/CDC42.

Rac1/2/3/CDC42 Antibody

ABF9178 100 ug
EUR 438

Phospho- Rac1/cdc42 (Ser71) Antibody

ABF3721 100 ug
EUR 438

Rabbit Cdc42 effector protein 1(CDC42EP1) ELISA kit

E04C1515-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 1(CDC42EP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 1(CDC42EP1) ELISA kit

E04C1515-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 1(CDC42EP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 1(CDC42EP1) ELISA kit

E04C1515-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 1(CDC42EP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 2(CDC42EP2) ELISA kit

E04C1516-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 2(CDC42EP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 2(CDC42EP2) ELISA kit

E04C1516-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 2(CDC42EP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 2(CDC42EP2) ELISA kit

E04C1516-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 2(CDC42EP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 3(CDC42EP3) ELISA kit

E04C1517-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 3(CDC42EP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 3(CDC42EP3) ELISA kit

E04C1517-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 3(CDC42EP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 3(CDC42EP3) ELISA kit

E04C1517-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 3(CDC42EP3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 4(CDC42EP4) ELISA kit

E04C1518-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cdc42 effector protein 4(CDC42EP4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 4(CDC42EP4) ELISA kit

E04C1518-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cdc42 effector protein 4(CDC42EP4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 4(CDC42EP4) ELISA kit

E04C1518-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cdc42 effector protein 4(CDC42EP4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 5(CDC42EP5) ELISA kit

E04C1519-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 5(CDC42EP5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 5(CDC42EP5) ELISA kit

E04C1519-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 5(CDC42EP5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 effector protein 5(CDC42EP5) ELISA kit

E04C1519-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 effector protein 5(CDC42EP5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Activated CDC42 kinase 1(TNK2) ELISA kit

E04A2011-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Activated CDC42 kinase 1(TNK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Activated CDC42 kinase 1(TNK2) ELISA kit

E04A2011-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Activated CDC42 kinase 1(TNK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Activated CDC42 kinase 1(TNK2) ELISA kit

E04A2011-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Activated CDC42 kinase 1(TNK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 interacting protein 4(TRIP10) ELISA kit

E04C2465-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 interacting protein 4(TRIP10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 interacting protein 4(TRIP10) ELISA kit

E04C2465-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 interacting protein 4(TRIP10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cdc42 interacting protein 4(TRIP10) ELISA kit

E04C2465-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cdc42 interacting protein 4(TRIP10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CDC42 Blocking Peptide

33R-2092 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CDC42 antibody, catalog no. 70R-10438

CDC42 Blocking Peptide

DF6322-BP 1mg
EUR 195

CDC42 Blocking Peptide

DF2308-BP 1mg
EUR 195

CDC42 Blocking Peptide

20-abx062391
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Cdc42 Recombinant Adenovirus

ADV-152 50 ?L
EUR 891
Description: Premade recombinant adenovirus containing the Cdc42 gene

CDC42 cloning plasmid

CSB-CL005008HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 576
  • Sequence: atgcagacaattaagtgtgttgttgtgggcgatggtgctgttggtaaaacatgtctcctgatatcctacacaacaaacaaatttccatcggaatatgtaccgactgtttttgacaactatgcagtcacagttatgattggtggagaaccatatactcttggactttttgatactgc
  • Show more
Description: A cloning plasmid for the CDC42 gene.

pCMV-SPORT6-CDC42

PVT18328 2 ug
EUR 231

Cdc42 Activation Assay

STA-402 20 assays
EUR 757
Description: Our Cdc42 Activation Assays use visible agarose beads to selectively precipitate the active form of Cdc42 protein. The precipitated small GTPase is then detected by Western blot using a Cdc42-specific antibody included in the kit.

Rac/cdc42 guanine nucleotide exchange factor 6 (ARHGEF6) polyclonal antibody

ABP-PAB-11264 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Cell Division Cycle Protein 42 (CDC42) Polyclonal Antibody (Human), APC

4-PAE614Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDC42 (Met1~Cys188)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cell Division Cycle Protein 42 (CDC42). This antibody is labeled with APC.

Cell Division Cycle Protein 42 (CDC42) Polyclonal Antibody (Human), Biotinylated

4-PAE614Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDC42 (Met1~Cys188)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cell Division Cycle Protein 42 (CDC42). This antibody is labeled with Biotin.

Cell Division Cycle Protein 42 (CDC42) Polyclonal Antibody (Human), Cy3

4-PAE614Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDC42 (Met1~Cys188)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cell Division Cycle Protein 42 (CDC42). This antibody is labeled with Cy3.

Cell Division Cycle Protein 42 (CDC42) Polyclonal Antibody (Human), FITC

4-PAE614Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDC42 (Met1~Cys188)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cell Division Cycle Protein 42 (CDC42). This antibody is labeled with FITC.

Cell Division Cycle Protein 42 (CDC42) Polyclonal Antibody (Human), HRP

4-PAE614Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDC42 (Met1~Cys188)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cell Division Cycle Protein 42 (CDC42). This antibody is labeled with HRP.

Cell Division Cycle Protein 42 (CDC42) Polyclonal Antibody (Human), PE

4-PAE614Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDC42 (Met1~Cys188)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cell Division Cycle Protein 42 (CDC42). This antibody is labeled with PE.

CDC42 Rabbit Polyclonal Antibody